RchiOBHm_Chr7g0228251

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
51593152 .. 51594305
1154 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20445

Sequence Viewer

Length: 168 bp
ATGGGCCTTGGAAGCTGCTTGTGCAACCTGTATCTGAACAATCAGCAAGTAGCTGGTAAATGTTTCTCTGAAAGATTCGGTGGACATCCTCTTACTCAAACTCTGCCAACATCACCGTCCCAGGATATCTCACCTAATGACATGTATCTACTACAATCACTACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.03

Weight (kDa)

5.96

Isoelectric Point (pI)

70.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018182)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 141
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 2 cut(s) 15, 53
AluI AGCT 2 cut(s) 15, 53
AoxI GGCC 1 cut(s) 4
ApeKI GCWGC 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 105, 123
BbvI GCAGC 1 cut(s) 2
BciT130I CCWGG 1 cut(s) 122
BisI GCNGC 1 cut(s) 16
BlsI GCNGC 1 cut(s) 17
Bme1390I CCNGG 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 7, 120
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 2 cut(s) 7, 120
BseGI GGATG 1 cut(s) 85
BseXI GCAGC 1 cut(s) 2
BshFI GGCC 1 cut(s) 6
BslFI GGGAC 1 cut(s) 103
BsmFI GGGAC 1 cut(s) 103
BsnI GGCC 1 cut(s) 6
BspANI GGCC 1 cut(s) 6
BssECI CCNNGG 2 cut(s) 7, 120
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 117
BstF5I GGATG 1 cut(s) 85
BstMWI GCNNNNNNNGC 2 cut(s) 12, 21
BstNI CCWGG 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 120
BstV1I GCAGC 1 cut(s) 2
BsuRI GGCC 1 cut(s) 6
BtsCI GGATG 1 cut(s) 85
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 142
CviJI RGCY 3 cut(s) 6, 15, 53
CviKI_1 RGCY 3 cut(s) 6, 15, 53
Eco130I CCWWGG 1 cut(s) 7
Eco32I GATATC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 120
EcoRV GATATC 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 1 cut(s) 145
FaiI YATR 1 cut(s) 143
FaqI GGGAC 1 cut(s) 103
FatI CATG 1 cut(s) 141
Fnu4HI GCNGC 1 cut(s) 16
FokI GGATG 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 16
GluI GCNGC 1 cut(s) 16
HaeIII GGCC 1 cut(s) 6
Hin1II CATG 1 cut(s) 145
HinfI GANTC 1 cut(s) 75
HphI GGTGA 2 cut(s) 105, 123
Hpy166II GTNNAC 1 cut(s) 83
Hpy188I TCNGA 2 cut(s) 36, 70
Hpy8I GTNNAC 1 cut(s) 83
HpyCH4III ACNGT 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 24
HpyF10VI GCNNNNNNNGC 2 cut(s) 12, 21
Hsp92II CATG 1 cut(s) 145
LpnPI CCDG 4 cut(s) 39, 41, 107, 134
Lsp1109I GCAGC 1 cut(s) 2
MnlI CCTC 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 2 cut(s) 12, 21
NlaIII CATG 1 cut(s) 145
NspI RCATGY 1 cut(s) 145
PciI ACATGT 1 cut(s) 141
PfeI GAWTC 1 cut(s) 75
PkrI GCNGC 1 cut(s) 17
PscI ACATGT 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspPI GGNCC 1 cut(s) 4
SatI GCNGC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 122
SetI ASST 4 cut(s) 17, 30, 55, 136
SgeI CNNG 8 cut(s) 20, 31, 40, 59, 66, 133, 134, 154
StyD4I CCNGG 1 cut(s) 120
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 117
TfiI GAWTC 1 cut(s) 75
TseI GCWGC 1 cut(s) 15
XceI RCATGY 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.