Rw7G033350

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
49085166 .. 49087065
1900 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G033350.1

Sequence Viewer

Length: 303 bp
ATGGTGGTTCATAGGCTTTATGCTTCTAAAACTTGGAGGCTTAAAACCATAGGCATAAAATGTTGCCAGGCTACATTTATGAACCACTTTGAAGCTTATGGCATTGGAGTTATCAAGATGATTAAGTGCTACATAGGTAGGATGGATTGTCGAGCGGTCGTACACACCGCAAAAAACTTGCAAGTAGCCGGTAAATGTTGCTCTGAAAGATTTGGTGGACATCCTCTTACTCAAACTCTGCCAACATCACCATCCCAGGATATCTCACCAAATGACATGTATCTACTACAATCACTACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.26

Weight (kDa)

9.33

Isoelectric Point (pI)

37.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018182)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 155
AciI CCGC 2 cut(s) 155, 168
AfaI GTAC 1 cut(s) 162
AflIII ACRYGT 1 cut(s) 276
AgsI TTSAA 1 cut(s) 92
AjnI CCWGG 2 cut(s) 66, 255
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AsuHPI GGTGA 2 cut(s) 240, 258
BccI CCATC 2 cut(s) 136, 259
BciT130I CCWGG 2 cut(s) 68, 257
Bme1390I CCNGG 2 cut(s) 68, 257
BmrFI CCNGG 2 cut(s) 68, 257
BsaJI CCNNGG 1 cut(s) 255
Bse118I RCCGGY 1 cut(s) 188
BseBI CCWGG 2 cut(s) 68, 257
BseDI CCNNGG 1 cut(s) 255
BseGI GGATG 3 cut(s) 147, 220, 251
Bsh1285I CGRYCG 1 cut(s) 159
BsiEI CGRYCG 1 cut(s) 159
BsiSI CCGG 1 cut(s) 189
BspACI CCGC 2 cut(s) 155, 168
BsrBI CCGCTC 1 cut(s) 155
BsrFI RCCGGY 1 cut(s) 188
BssAI RCCGGY 1 cut(s) 188
BssECI CCNNGG 1 cut(s) 255
Bst2UI CCWGG 2 cut(s) 68, 257
BstF5I GGATG 3 cut(s) 147, 220, 251
BstMCI CGRYCG 1 cut(s) 159
BstNI CCWGG 2 cut(s) 68, 257
BstNSI RCATGY 1 cut(s) 280
BstSCI CCNGG 2 cut(s) 66, 255
BtsCI GGATG 3 cut(s) 147, 220, 251
Cfr10I RCCGGY 1 cut(s) 188
Csp6I GTAC 1 cut(s) 161
CviAII CATG 1 cut(s) 277
CviJI RGCY 5 cut(s) 16, 40, 71, 95, 188
CviKI_1 RGCY 5 cut(s) 16, 40, 71, 95, 188
CviQI GTAC 1 cut(s) 161
Eco32I GATATC 1 cut(s) 262
EcoRII CCWGG 2 cut(s) 66, 255
EcoRV GATATC 1 cut(s) 262
FaeI CATG 1 cut(s) 280
FaiI YATR 8 cut(s) 12, 21, 50, 56, 80, 99, 134, 278
FatI CATG 1 cut(s) 276
FokI GGATG 3 cut(s) 154, 207, 238
HapII CCGG 1 cut(s) 189
Hin1II CATG 1 cut(s) 280
HindIII AAGCTT 1 cut(s) 93
HpaII CCGG 1 cut(s) 189
HphI GGTGA 2 cut(s) 240, 258
Hpy166II GTNNAC 2 cut(s) 163, 218
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 115
Hpy8I GTNNAC 2 cut(s) 163, 218
HpyCH4V TGCA 1 cut(s) 181
Hsp92II CATG 1 cut(s) 280
LpnPI CCDG 5 cut(s) 53, 80, 202, 242, 269
MbiI CCGCTC 1 cut(s) 155
MnlI CCTC 2 cut(s) 30, 234
MseI TTAA 2 cut(s) 42, 123
MspI CCGG 1 cut(s) 189
MspR9I CCNGG 2 cut(s) 68, 257
MvaI CCWGG 2 cut(s) 68, 257
NlaIII CATG 1 cut(s) 280
NspI RCATGY 1 cut(s) 280
PciI ACATGT 1 cut(s) 276
PscI ACATGT 1 cut(s) 276
Psp6I CCWGG 2 cut(s) 66, 255
PspGI CCWGG 2 cut(s) 66, 255
RsaI GTAC 1 cut(s) 162
RsaNI GTAC 1 cut(s) 161
SaqAI TTAA 2 cut(s) 42, 123
ScrFI CCNGG 2 cut(s) 68, 257
SetI ASST 2 cut(s) 97, 139
SsiI CCGC 2 cut(s) 155, 168
StyD4I CCNGG 2 cut(s) 66, 255
TaqI TCGA 1 cut(s) 151
Tru1I TTAA 2 cut(s) 42, 123
Tru9I TTAA 2 cut(s) 42, 123
TspDTI ATGAA 1 cut(s) 95
XceI RCATGY 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.