RchiOBHm_Chr7g0235751

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
60669360 .. 60671805
2446 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21126

Sequence Viewer

Length: 195 bp
ATGCCTCGTATGATACTGCACTCCAACACATCTTTGACAACTAATGTGTCGAAATATCTTATGCACTTAAACAAAGTTTTGAGTTGTCATTTTGCCATTCCACCAACTTGCTTTCAACTTTCCCCTTTTTTGTTGTTGTTCTGCATCTTGACTTGTGGTCCTCAGAAACACACAGCTGTCGACCAGTGGTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.35

Weight (kDa)

8.86

Isoelectric Point (pI)

49.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018948)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 180
AgsI TTSAA 1 cut(s) 116
AhdI GACNNNNNGTC 1 cut(s) 156
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
AspS9I GGNCC 1 cut(s) 158
AvaII GGWCC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 158
BmeRI GACNNNNNGTC 1 cut(s) 156
BmgT120I GGNCC 1 cut(s) 158
BmsI GCATC 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 184
BseMII CTCAG 1 cut(s) 176
BseNI ACTGG 1 cut(s) 184
BspCNI CTCAG 1 cut(s) 175
BsrI ACTGG 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 162
BtsIMutI CAGTG 1 cut(s) 191
Cfr13I GGNCC 1 cut(s) 158
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
DdeI CTNAG 1 cut(s) 162
DriI GACNNNNNGTC 1 cut(s) 156
Eam1105I GACNNNNNGTC 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 158
FaiI YATR 2 cut(s) 11, 62
FblI GTMKAC 1 cut(s) 180
HincII GTYRAC 1 cut(s) 181
HindII GTYRAC 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 165
Hpy188III TCNNGA 1 cut(s) 148
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 19, 64, 144
HpyF3I CTNAG 1 cut(s) 162
LweI GCATC 1 cut(s) 153
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 2 cut(s) 15, 171
MseI TTAA 2 cut(s) 68, 193
MspA1I CMGCKG 1 cut(s) 176
PspPI GGNCC 1 cut(s) 158
PvuII CAGCTG 1 cut(s) 176
SalI GTCGAC 1 cut(s) 179
SaqAI TTAA 2 cut(s) 68, 193
Sau96I GGNCC 1 cut(s) 158
SetI ASST 1 cut(s) 178
SfaNI GCATC 1 cut(s) 153
SgeI CNNG 4 cut(s) 18, 120, 160, 165
SinI GGWCC 1 cut(s) 158
TaqI TCGA 2 cut(s) 50, 180
Tru1I TTAA 2 cut(s) 68, 193
Tru9I TTAA 2 cut(s) 68, 193
TscAI CASTG 1 cut(s) 191
TspRI CASTG 1 cut(s) 191
VpaK11BI GGWCC 1 cut(s) 158
XmiI GTMKAC 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.