Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr2

Orthogroup ID

OG0018983

Physical Location & Seq

Genomic Coordinates Reverse (-)

24009480 .. 24010114

Gene Structure 635 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000007991

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

ATGCTCAGCTCGAATCTGGCTTTAATGGAGGTCAACAAGATGCCTTCAAAGGACAAGAAGAACTCAAAGGCCCAATCGAGGCTGTCCAATTCTGATAGCTTTGCCTCTTCTGGGTCGATCGATTTTGAACCCAATGAAGTGGGTTTTGCCCCCTCTCTTGAACAAGCTTCCAGCAAATATCTATATCTGATTGGGAAATCTGCTTTCATTCGTCAAGTCACCGATGTCGATGACACCTCCAAAGGCTGTAAAATTTGGCTTTCAGAGCCTTCCGTGGTTGCCAATTCCTTCACTCCTGGCTCCATTGTATCGGTAATGTATTCTATATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0031976 GO:0031984 GO:0034357 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035

KEGG Pathways

Metabolic & Signaling

ko03008 map03008

Pfam Domains

Protein Families

AAA

Protein Analysis

110

Amino Acids

11.79

Weight (kDa)

6.19

Isoelectric Point (pI)

41.58

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DPBB_CI111	PF26429	52 - 105	3.4e-17	CI111 double-psi beta barrel domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018983)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0126221
rosa_laevigata	RLG00000002694 RLG00000007991
rosa_roxburghii	Rroxscaffold_2G00117370 Rroxscaffold_2G00148290
rosa_samantha	Rh1BG184500 Rh2AG318800 Rh3BG281300 Rh6BG474200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	252
AfiI	CCNNNNNNNGG	2 cut(s)	78, 111
AgsI	TTSAA	3 cut(s)	48, 128, 161
AjnI	CCWGG	1 cut(s)	295
AluBI	AGCT	3 cut(s)	9, 99, 167
AluI	AGCT	3 cut(s)	9, 99, 167
AoxI	GGCC	1 cut(s)	69
ApoI	RAATTY	1 cut(s)	252
AspS9I	GGNCC	1 cut(s)	70
AsuHPI	GGTGA	1 cut(s)	211
BciT130I	CCWGG	1 cut(s)	297
BlpI	GCTNAGC	1 cut(s)	5
Bme1390I	CCNGG	1 cut(s)	297
BmgT120I	GGNCC	1 cut(s)	70
BmiI	GGNNCC	1 cut(s)	301
BmrFI	CCNGG	1 cut(s)	297
BmsI	GCATC	1 cut(s)	30
Bpu1102I	GCTNAGC	1 cut(s)	5
Bsa29I	ATCGAT	1 cut(s)	120
BsaJI	CCNNGG	1 cut(s)	273
Bsc4I	CCNNNNNNNGG	2 cut(s)	78, 111
BseBI	CCWGG	1 cut(s)	297
BseCI	ATCGAT	1 cut(s)	120
BseDI	CCNNGG	1 cut(s)	273
BseLI	CCNNNNNNNGG	2 cut(s)	78, 111
BseMII	CTCAG	1 cut(s)	19
Bsh1285I	CGRYCG	1 cut(s)	120
BshFI	GGCC	1 cut(s)	71
BshVI	ATCGAT	1 cut(s)	120
BsiEI	CGRYCG	1 cut(s)	120
BslI	CCNNNNNNNGG	2 cut(s)	78, 111
BsnI	GGCC	1 cut(s)	71
Bsp143I	GATC	1 cut(s)	117
Bsp1720I	GCTNAGC	1 cut(s)	5
BspANI	GGCC	1 cut(s)	71
BspCNI	CTCAG	1 cut(s)	18
BspDI	ATCGAT	1 cut(s)	120
BspLI	GGNNCC	1 cut(s)	301
BssECI	CCNNGG	1 cut(s)	273
BssMI	GATC	1 cut(s)	117
Bst2UI	CCWGG	1 cut(s)	297
Bst6I	CTCTTC	1 cut(s)	112
BstDEI	CTNAG	1 cut(s)	5
BstDSI	CCRYGG	1 cut(s)	273
BstKTI	GATC	1 cut(s)	120
BstMBI	GATC	1 cut(s)	117
BstMCI	CGRYCG	1 cut(s)	120
BstMWI	GCNNNNNNNGC	1 cut(s)	265
BstNI	CCWGG	1 cut(s)	297
BstSCI	CCNGG	1 cut(s)	295
BstXI	CCANNNNNNTGG	1 cut(s)	139
Bsu15I	ATCGAT	1 cut(s)	120
BsuRI	GGCC	1 cut(s)	71
BsuTUI	ATCGAT	1 cut(s)	120
BtgI	CCRYGG	1 cut(s)	273
Cfr13I	GGNCC	1 cut(s)	70
ClaI	ATCGAT	1 cut(s)	120
DdeI	CTNAG	1 cut(s)	5
DpnI	GATC	1 cut(s)	119
DpnII	GATC	1 cut(s)	117
Eam1104I	CTCTTC	1 cut(s)	112
EarI	CTCTTC	1 cut(s)	112
EcoRII	CCWGG	1 cut(s)	295
FaiI	YATR	3 cut(s)	184, 326, 328
HaeIII	GGCC	1 cut(s)	71
HincII	GTYRAC	1 cut(s)	34
HindII	GTYRAC	1 cut(s)	34
HindIII	AAGCTT	1 cut(s)	165
HinfI	GANTC	1 cut(s)	13
HphI	GGTGA	1 cut(s)	211
Hpy166II	GTNNAC	1 cut(s)	34
Hpy188I	TCNGA	3 cut(s)	94, 189, 265
Hpy188III	TCNNGA	1 cut(s)	158
Hpy8I	GTNNAC	1 cut(s)	34
HpyAV	CCTTC	3 cut(s)	54, 279, 298
HpyF10VI	GCNNNNNNNGC	1 cut(s)	265
HpyF3I	CTNAG	1 cut(s)	5
Kzo9I	GATC	1 cut(s)	117
LmnI	GCTCC	1 cut(s)	305
LpnPI	CCDG	5 cut(s)	2, 96, 184, 282, 309
LweI	GCATC	1 cut(s)	30
MaeIII	GTNAC	1 cut(s)	217
MalI	GATC	1 cut(s)	119
MboI	GATC	1 cut(s)	117
MboII	GAAGA	2 cut(s)	70, 99
MluCI	AATT	3 cut(s)	88, 252, 283
MnlI	CCTC	5 cut(s)	22, 72, 115, 163, 247
MseI	TTAA	1 cut(s)	23
MspR9I	CCNGG	1 cut(s)	297
MvaI	CCWGG	1 cut(s)	297
MwoI	GCNNNNNNNGC	1 cut(s)	265
NdeII	GATC	1 cut(s)	117
NlaIV	GGNNCC	1 cut(s)	301
NmuCI	GTSAC	1 cut(s)	217
PfeI	GAWTC	1 cut(s)	13
Ple19I	CGATCG	1 cut(s)	120
Psp6I	CCWGG	1 cut(s)	295
PspGI	CCWGG	1 cut(s)	295
PspN4I	GGNNCC	1 cut(s)	301
PspPI	GGNCC	1 cut(s)	70
PvuI	CGATCG	1 cut(s)	120
SaqAI	TTAA	1 cut(s)	23
Sau3AI	GATC	1 cut(s)	117
Sau96I	GGNCC	1 cut(s)	70
ScrFI	CCNGG	1 cut(s)	297
SetI	ASST	5 cut(s)	11, 33, 101, 169, 239
SfaNI	GCATC	1 cut(s)	30
Sse9I	AATT	3 cut(s)	88, 252, 283
StyD4I	CCNGG	1 cut(s)	295
TaqI	TCGA	5 cut(s)	11, 77, 116, 120, 228
TasI	AATT	3 cut(s)	88, 252, 283
TfiI	GAWTC	1 cut(s)	13
Tru1I	TTAA	1 cut(s)	23
Tru9I	TTAA	1 cut(s)	23
TseFI	GTSAC	1 cut(s)	217
Tsp45I	GTSAC	1 cut(s)	217
TspDTI	ATGAA	2 cut(s)	150, 196
TspGWI	ACGGA	1 cut(s)	262
XapI	RAATTY	1 cut(s)	252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.