Rh3BG281300

Calmodulin-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
27837657 .. 27839094
1438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG281300.1

Sequence Viewer

Length: 342 bp
ATGCTCAGCTCGAATCTGGCTTCAATGGAGGTCAACAAGATGCCTTCAAAGGGTAAGAAGAACTCAAAGGCCCAATCGAGGCTGTCCAATTCTGACAGCTTTGCCTCTTCTAGGTCGATTGATTTTGAACCCAATGAAGTGGGTTTTGCCACCTCTCTTGAACAAGCTTCCAGCAAATACCTATCTCTGATTGGAAAATTTGCTTTCATTGGTCAAGTCACCGATGTCGATGACACCTCCAAAGGCTGTAAAAATTGGCTTTCAGAACCTTCCATGGTTGCCAATTCCTTCACTCCTGGCTCCATTGTATCGGTGCAAAGGTTTAGTTATATGACGCAGTGA

Protein Analysis

113

Amino Acids

12.28

Weight (kDa)

8.79

Isoelectric Point (pI)

40.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DPBB_CI111 PF26429 52 - 106 2e-17 CI111 double-psi beta barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018983)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 197
AfiI CCNNNNNNNGG 3 cut(s) 50, 78, 111
AgsI TTSAA 4 cut(s) 24, 48, 128, 161
AjnI CCWGG 1 cut(s) 295
AluBI AGCT 3 cut(s) 9, 99, 167
AluI AGCT 3 cut(s) 9, 99, 167
AoxI GGCC 1 cut(s) 69
ApoI RAATTY 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 70
AsuHPI GGTGA 1 cut(s) 211
BciT130I CCWGG 1 cut(s) 297
BfaI CTAG 1 cut(s) 111
BlpI GCTNAGC 1 cut(s) 5
Bme1390I CCNGG 1 cut(s) 297
BmgT120I GGNCC 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 297
BmsI GCATC 1 cut(s) 30
Bpu1102I GCTNAGC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 273
Bsc4I CCNNNNNNNGG 3 cut(s) 50, 78, 111
BseBI CCWGG 1 cut(s) 297
BseDI CCNNGG 1 cut(s) 273
BseLI CCNNNNNNNGG 3 cut(s) 50, 78, 111
BseMII CTCAG 1 cut(s) 19
BshFI GGCC 1 cut(s) 71
BslI CCNNNNNNNGG 3 cut(s) 50, 78, 111
BsnI GGCC 1 cut(s) 71
Bsp1720I GCTNAGC 1 cut(s) 5
Bsp19I CCATGG 1 cut(s) 273
BspANI GGCC 1 cut(s) 71
BspCNI CTCAG 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 301
BssECI CCNNGG 1 cut(s) 273
BssT1I CCWWGG 1 cut(s) 273
Bst2UI CCWGG 1 cut(s) 297
Bst6I CTCTTC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 5
BstDSI CCRYGG 1 cut(s) 273
BstENI CCTNNNNNAGG 1 cut(s) 109
BstNI CCWGG 1 cut(s) 297
BstSCI CCNGG 1 cut(s) 295
BstXI CCANNNNNNTGG 1 cut(s) 139
BsuRI GGCC 1 cut(s) 71
BtgI CCRYGG 1 cut(s) 273
Cfr13I GGNCC 1 cut(s) 70
CspCI CAANNNNNGTGG 2 cut(s) 139, 174
CviAII CATG 1 cut(s) 274
CviJI RGCY 9 cut(s) 9, 20, 71, 82, 99, 167, 246, 259, 300
CviKI_1 RGCY 9 cut(s) 9, 20, 71, 82, 99, 167, 246, 259, 300
DdeI CTNAG 1 cut(s) 5
Eam1104I CTCTTC 1 cut(s) 112
EarI CTCTTC 1 cut(s) 112
Eco130I CCWWGG 1 cut(s) 273
EcoNI CCTNNNNNAGG 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 295
EcoT14I CCWWGG 1 cut(s) 273
ErhI CCWWGG 1 cut(s) 273
FaeI CATG 1 cut(s) 277
FaiI YATR 3 cut(s) 275, 330, 332
FatI CATG 1 cut(s) 273
FspBI CTAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 71
Hin1II CATG 1 cut(s) 277
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HindIII AAGCTT 1 cut(s) 165
HinfI GANTC 1 cut(s) 13
HphI GGTGA 1 cut(s) 211
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 3 cut(s) 94, 189, 265
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 3 cut(s) 54, 279, 298
HpyCH4V TGCA 1 cut(s) 316
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 1 cut(s) 277
LmnI GCTCC 1 cut(s) 305
LpnPI CCDG 4 cut(s) 2, 184, 282, 309
LweI GCATC 1 cut(s) 30
MaeI CTAG 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 217
MboII GAAGA 2 cut(s) 70, 99
MluCI AATT 4 cut(s) 88, 197, 253, 283
MnlI CCTC 5 cut(s) 22, 72, 115, 163, 247
MspR9I CCNGG 1 cut(s) 297
MvaI CCWGG 1 cut(s) 297
NcoI CCATGG 1 cut(s) 273
NlaIII CATG 1 cut(s) 277
NlaIV GGNNCC 1 cut(s) 301
NmuCI GTSAC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 295
PspGI CCWGG 1 cut(s) 295
PspN4I GGNNCC 1 cut(s) 301
PspPI GGNCC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 297
SfaNI GCATC 1 cut(s) 30
Sse9I AATT 4 cut(s) 88, 197, 253, 283
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 295
StyI CCWWGG 1 cut(s) 273
TaqI TCGA 4 cut(s) 11, 77, 116, 228
TasI AATT 4 cut(s) 88, 197, 253, 283
TfiI GAWTC 1 cut(s) 13
TseFI GTSAC 1 cut(s) 217
Tsp45I GTSAC 1 cut(s) 217
TspDTI ATGAA 2 cut(s) 150, 196
XagI CCTNNNNNAGG 1 cut(s) 109
XapI RAATTY 1 cut(s) 197
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.