RLG00000008435

CRIB domain-containing protein RIC4-like

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Forward (+)
30539045 .. 30540727
1683 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008435

Sequence Viewer

Length: 543 bp
ATGGAAAGATTCGCTGTTCTCCCTTTCGGATTCGGCTGCACTTCTCACTCCAGCGTTGATCTCGGCGAAGCAACTCAACCACGAAAACCAAAAGTCAGAGCAGCACCACCAAAACCACCACCTCCTGAACTAACAGATGATGGAAGAACACAAGGAAGATCTGCAATGAAGAACTCTTTTCATTTCCTGAGTCAAGGGAAGCAGCACATATCTAGTCGAATGCAGAGATTGATCAGAAGCATCAAAAATTTCTCTCAAATATTTGTTTACAAGGAAGAAACTGAAGAAAAGGAAACAGAGATGGAGATTGGATTCCCAACGGACGTGAAGCATGTGACACACATAGGATTGGACGGCTCTACCACTACAAATAATAATCTCAACAATTTTAATAGCAATGCTGCTCCTCCTCCTGAAGTAGTTTCCTTCCCTTCGATTTCTCTGAAGCAATTTGAGTTGGTCATGGCTGCACAGACCACCCACCAACCCCCTCATAATCAGAAGCTCCTTGTTGATCTCAAATCTTCCCAAGATCTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

181

Amino Acids

20.08

Weight (kDa)

7.93

Isoelectric Point (pI)

48.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012882)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 247
AcuI CTGAAG 3 cut(s) 303, 435, 464
AjiI CACGTC 1 cut(s) 325
AluBI AGCT 1 cut(s) 505
AluI AGCT 1 cut(s) 505
ApeKI GCWGC 5 cut(s) 36, 101, 202, 401, 467
ApoI RAATTY 1 cut(s) 247
BbvI GCAGC 5 cut(s) 23, 113, 214, 388, 454
BccI CCATC 2 cut(s) 134, 295
BceAI ACGGC 1 cut(s) 370
BclI TGATCA 1 cut(s) 231
BfaI CTAG 1 cut(s) 213
BglII AGATCT 2 cut(s) 158, 532
BisI GCNGC 5 cut(s) 37, 102, 203, 402, 468
BlsI GCNGC 5 cut(s) 38, 103, 204, 403, 469
BmgBI CACGTC 1 cut(s) 325
BmsI GCATC 1 cut(s) 249
BpmI CTGGAG 1 cut(s) 34
Bse3DI GCAATG 2 cut(s) 171, 403
BseMI GCAATG 2 cut(s) 171, 403
BseMII CTCAG 1 cut(s) 179
BseRI GAGGAG 2 cut(s) 396, 399
BseXI GCAGC 5 cut(s) 23, 113, 214, 388, 454
BsgI GTGCAG 2 cut(s) 22, 453
BsmI GAATGC 1 cut(s) 225
Bsp143I GATC 5 cut(s) 58, 158, 231, 514, 532
BspCNI CTCAG 1 cut(s) 180
BsrDI GCAATG 2 cut(s) 171, 403
BssMI GATC 5 cut(s) 58, 158, 231, 514, 532
BstDEI CTNAG 1 cut(s) 188
BstKTI GATC 5 cut(s) 61, 161, 234, 517, 535
BstMBI GATC 5 cut(s) 58, 158, 231, 514, 532
BstNSI RCATGY 1 cut(s) 335
BstV1I GCAGC 5 cut(s) 23, 113, 214, 388, 454
BstX2I RGATCY 2 cut(s) 158, 532
BstYI RGATCY 2 cut(s) 158, 532
BtrI CACGTC 1 cut(s) 325
CviAII CATG 2 cut(s) 332, 463
CviJI RGCY 4 cut(s) 36, 357, 467, 505
CviKI_1 RGCY 4 cut(s) 36, 357, 467, 505
DdeI CTNAG 1 cut(s) 188
DpnI GATC 5 cut(s) 60, 160, 233, 516, 534
DpnII GATC 5 cut(s) 58, 158, 231, 514, 532
Eco57I CTGAAG 3 cut(s) 303, 435, 464
FaeI CATG 2 cut(s) 335, 466
FaiI YATR 5 cut(s) 209, 333, 344, 464, 495
FatI CATG 2 cut(s) 331, 462
FbaI TGATCA 1 cut(s) 231
Fnu4HI GCNGC 5 cut(s) 37, 102, 203, 402, 468
Fsp4HI GCNGC 5 cut(s) 37, 102, 203, 402, 468
FspBI CTAG 1 cut(s) 213
GluI GCNGC 5 cut(s) 37, 102, 203, 402, 468
GsuI CTGGAG 1 cut(s) 34
Hin1II CATG 2 cut(s) 335, 466
HinfI GANTC 4 cut(s) 9, 30, 190, 312
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 5 cut(s) 29, 98, 236, 444, 501
Hpy188III TCNNGA 3 cut(s) 125, 187, 413
Hpy8I GTNNAC 1 cut(s) 268
HpyAV CCTTC 2 cut(s) 436, 441
HpyCH4IV ACGT 1 cut(s) 324
HpyCH4V TGCA 4 cut(s) 39, 164, 223, 470
HpyF3I CTNAG 1 cut(s) 188
HpySE526I ACGT 1 cut(s) 324
Hsp92II CATG 2 cut(s) 335, 466
Ksp22I TGATCA 1 cut(s) 231
Kzo9I GATC 5 cut(s) 58, 158, 231, 514, 532
LmnI GCTCC 2 cut(s) 409, 510
LpnPI CCDG 4 cut(s) 64, 138, 200, 426
Lsp1109I GCAGC 5 cut(s) 23, 113, 214, 388, 454
LweI GCATC 1 cut(s) 249
MaeI CTAG 1 cut(s) 213
MaeII ACGT 1 cut(s) 324
MaeIII GTNAC 1 cut(s) 334
MalI GATC 5 cut(s) 60, 160, 233, 516, 534
MboI GATC 5 cut(s) 58, 158, 231, 514, 532
MboII GAAGA 6 cut(s) 156, 168, 181, 287, 296, 516
MflI RGATCY 2 cut(s) 158, 532
MluCI AATT 4 cut(s) 247, 385, 449, 538
MlyI GAGTC 1 cut(s) 199
MnlI CCTC 4 cut(s) 132, 417, 420, 501
MseI TTAA 3 cut(s) 390, 537, 541
Mva1269I GAATGC 1 cut(s) 225
NdeII GATC 5 cut(s) 58, 158, 231, 514, 532
NlaIII CATG 2 cut(s) 335, 466
NmeAIII GCCGAG 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 334
NspI RCATGY 1 cut(s) 335
PacI TTAATTAA 1 cut(s) 541
PctI GAATGC 1 cut(s) 225
PfeI GAWTC 3 cut(s) 9, 30, 312
PkrI GCNGC 5 cut(s) 38, 103, 204, 403, 469
PleI GAGTC 1 cut(s) 198
PpsI GAGTC 1 cut(s) 198
PsuI RGATCY 2 cut(s) 158, 532
SaqAI TTAA 3 cut(s) 390, 537, 541
SatI GCNGC 5 cut(s) 37, 102, 203, 402, 468
Sau3AI GATC 5 cut(s) 58, 158, 231, 514, 532
SchI GAGTC 1 cut(s) 199
SetI ASST 3 cut(s) 124, 327, 507
SfaNI GCATC 1 cut(s) 249
Sse9I AATT 4 cut(s) 247, 385, 449, 538
SspI AATATT 1 cut(s) 261
SspMI CTAG 1 cut(s) 213
TaiI ACGT 1 cut(s) 327
TaqI TCGA 2 cut(s) 217, 434
TasI AATT 4 cut(s) 247, 385, 449, 538
TfiI GAWTC 3 cut(s) 9, 30, 312
Tru1I TTAA 3 cut(s) 390, 537, 541
Tru9I TTAA 3 cut(s) 390, 537, 541
TseFI GTSAC 1 cut(s) 334
TseI GCWGC 5 cut(s) 36, 101, 202, 401, 467
Tsp45I GTSAC 1 cut(s) 334
TspDTI ATGAA 2 cut(s) 170, 182
TspGWI ACGGA 1 cut(s) 335
XapI RAATTY 1 cut(s) 247
XceI RCATGY 1 cut(s) 335
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.