Rw4G013340

CRIB domain-containing protein RIC4-like

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
31204643 .. 31206566
1924 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G013340.1

Sequence Viewer

Length: 579 bp
ATGTCTTTAATTCAAACCAAGAGGCTTCATTTCCTTATGGAAAGATTCGCTGTTCTCCCTTTCGGATTCGGCTGCACTTCTCACTCCAGCGTTGATCTCGGCGAAGCAACTCAACCACGAAAACCAAAAGTCAGAGCAGCACCACCAAACCCACCACCTCCTGAATCAACAGATGATGGAAGAACACAAGGAAGATCAGCAACGAAGAACTCTTTTCATTTCCTGGGTCAAGGGAAGCAGCACATATCTAGTCGGATGCAGAGATTGATCAGAAGCATCAAAAATTTCTCTCAAATATTTGTTTTCAAGGAAGAAACTGAAGAAAAGGAAACAGAGATGGAGATTGGATTCCCAACGGACGTGAAGCATGTGACACACATAGGATTGGATGGCTCTACCACTACAAATAATAATCTCAACAATTTTAATAGCAATGCTACTCCTCCTCCTGAAGTAGTTTCCTTCCCTTCGATTTCTCTGAAGCAATTTGAGTTGGTCATGGCTGCACAGACCACCCACCAACCCCCTCATAATCAGAAGCTCCTTATTGATCTCAAATCTTCCCAGGATCTTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

192

Amino Acids

21.48

Weight (kDa)

8.76

Isoelectric Point (pI)

48.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012882)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 576
AcsI RAATTY 1 cut(s) 283
AcuI CTGAAG 3 cut(s) 339, 471, 500
AgsI TTSAA 2 cut(s) 14, 307
AjiI CACGTC 1 cut(s) 361
AjnI CCWGG 2 cut(s) 222, 564
AluBI AGCT 1 cut(s) 541
AluI AGCT 1 cut(s) 541
AlwI GGATC 1 cut(s) 576
ApeKI GCWGC 4 cut(s) 72, 137, 238, 503
ApoI RAATTY 1 cut(s) 283
BbvI GCAGC 4 cut(s) 59, 149, 250, 490
BccI CCATC 3 cut(s) 170, 331, 383
BciT130I CCWGG 2 cut(s) 224, 566
BclI TGATCA 1 cut(s) 267
BfaI CTAG 1 cut(s) 249
BisI GCNGC 4 cut(s) 73, 138, 239, 504
BlsI GCNGC 4 cut(s) 74, 139, 240, 505
Bme1390I CCNGG 2 cut(s) 224, 566
BmgBI CACGTC 1 cut(s) 361
BmrFI CCNGG 2 cut(s) 224, 566
BmsI GCATC 2 cut(s) 246, 285
BpmI CTGGAG 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 223, 564
BsaXI ACNNNNNCTCC 2 cut(s) 430, 460
Bse3DI GCAATG 1 cut(s) 439
BseBI CCWGG 2 cut(s) 224, 566
BseDI CCNNGG 2 cut(s) 223, 564
BseGI GGATG 2 cut(s) 261, 394
BseMI GCAATG 1 cut(s) 439
BseRI GAGGAG 2 cut(s) 432, 435
BseXI GCAGC 4 cut(s) 59, 149, 250, 490
BsgI GTGCAG 2 cut(s) 58, 489
Bsp143I GATC 5 cut(s) 94, 194, 267, 550, 568
BspPI GGATC 1 cut(s) 576
BsrDI GCAATG 1 cut(s) 439
BssECI CCNNGG 2 cut(s) 223, 564
BssMI GATC 5 cut(s) 94, 194, 267, 550, 568
Bst2UI CCWGG 2 cut(s) 224, 566
BstF5I GGATG 2 cut(s) 261, 394
BstKTI GATC 5 cut(s) 97, 197, 270, 553, 571
BstMBI GATC 5 cut(s) 94, 194, 267, 550, 568
BstNI CCWGG 2 cut(s) 224, 566
BstNSI RCATGY 1 cut(s) 371
BstSCI CCNGG 2 cut(s) 222, 564
BstV1I GCAGC 4 cut(s) 59, 149, 250, 490
BstX2I RGATCY 1 cut(s) 568
BstYI RGATCY 1 cut(s) 568
BtrI CACGTC 1 cut(s) 361
BtsCI GGATG 2 cut(s) 261, 394
CviAII CATG 2 cut(s) 368, 499
CviJI RGCY 5 cut(s) 25, 72, 393, 503, 541
CviKI_1 RGCY 5 cut(s) 25, 72, 393, 503, 541
DpnI GATC 5 cut(s) 96, 196, 269, 552, 570
DpnII GATC 5 cut(s) 94, 194, 267, 550, 568
Eco57I CTGAAG 3 cut(s) 339, 471, 500
EcoRII CCWGG 2 cut(s) 222, 564
FaeI CATG 2 cut(s) 371, 502
FaiI YATR 6 cut(s) 38, 245, 369, 380, 500, 531
FatI CATG 2 cut(s) 367, 498
FbaI TGATCA 1 cut(s) 267
Fnu4HI GCNGC 4 cut(s) 73, 138, 239, 504
FokI GGATG 2 cut(s) 268, 401
Fsp4HI GCNGC 4 cut(s) 73, 138, 239, 504
FspBI CTAG 1 cut(s) 249
GluI GCNGC 4 cut(s) 73, 138, 239, 504
GsuI CTGGAG 1 cut(s) 70
Hin1II CATG 2 cut(s) 371, 502
HinfI GANTC 4 cut(s) 45, 66, 164, 348
Hpy188I TCNGA 6 cut(s) 65, 134, 255, 272, 480, 537
Hpy188III TCNNGA 2 cut(s) 161, 449
HpyAV CCTTC 2 cut(s) 472, 477
HpyCH4IV ACGT 1 cut(s) 360
HpyCH4V TGCA 3 cut(s) 75, 259, 506
HpySE526I ACGT 1 cut(s) 360
Hsp92II CATG 2 cut(s) 371, 502
Ksp22I TGATCA 1 cut(s) 267
Kzo9I GATC 5 cut(s) 94, 194, 267, 550, 568
LmnI GCTCC 1 cut(s) 546
LpnPI CCDG 6 cut(s) 100, 174, 209, 236, 462, 551
Lsp1109I GCAGC 4 cut(s) 59, 149, 250, 490
LweI GCATC 2 cut(s) 246, 285
MaeI CTAG 1 cut(s) 249
MaeII ACGT 1 cut(s) 360
MaeIII GTNAC 1 cut(s) 370
MalI GATC 5 cut(s) 96, 196, 269, 552, 570
MboI GATC 5 cut(s) 94, 194, 267, 550, 568
MboII GAAGA 6 cut(s) 192, 204, 217, 323, 332, 552
MflI RGATCY 1 cut(s) 568
MluCI AATT 5 cut(s) 9, 283, 421, 485, 574
MmeI TCCRAC 1 cut(s) 233
MnlI CCTC 5 cut(s) 15, 168, 453, 456, 537
MseI TTAA 3 cut(s) 8, 426, 573
MspR9I CCNGG 2 cut(s) 224, 566
MvaI CCWGG 2 cut(s) 224, 566
NdeII GATC 5 cut(s) 94, 194, 267, 550, 568
NlaIII CATG 2 cut(s) 371, 502
NmeAIII GCCGAG 1 cut(s) 78
NmuCI GTSAC 1 cut(s) 370
NspI RCATGY 1 cut(s) 371
PfeI GAWTC 4 cut(s) 45, 66, 164, 348
PkrI GCNGC 4 cut(s) 74, 139, 240, 505
Psp6I CCWGG 2 cut(s) 222, 564
PspGI CCWGG 2 cut(s) 222, 564
PsuI RGATCY 1 cut(s) 568
SaqAI TTAA 3 cut(s) 8, 426, 573
SatI GCNGC 4 cut(s) 73, 138, 239, 504
Sau3AI GATC 5 cut(s) 94, 194, 267, 550, 568
ScrFI CCNGG 2 cut(s) 224, 566
SetI ASST 3 cut(s) 160, 363, 543
SfaNI GCATC 2 cut(s) 246, 285
Sse9I AATT 5 cut(s) 9, 283, 421, 485, 574
SspI AATATT 1 cut(s) 297
SspMI CTAG 1 cut(s) 249
StyD4I CCNGG 2 cut(s) 222, 564
TaiI ACGT 1 cut(s) 363
TaqI TCGA 1 cut(s) 470
TasI AATT 5 cut(s) 9, 283, 421, 485, 574
TfiI GAWTC 4 cut(s) 45, 66, 164, 348
Tru1I TTAA 3 cut(s) 8, 426, 573
Tru9I TTAA 3 cut(s) 8, 426, 573
TseFI GTSAC 1 cut(s) 370
TseI GCWGC 4 cut(s) 72, 137, 238, 503
Tsp45I GTSAC 1 cut(s) 370
TspDTI ATGAA 2 cut(s) 17, 206
TspGWI ACGGA 1 cut(s) 371
XapI RAATTY 1 cut(s) 283
XceI RCATGY 1 cut(s) 371
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.