RLG00000012575

Calcineurin-like phosphoesterase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0003480
Physical Location & Seq
Forward (+)
20016540 .. 20018490
1951 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000012575

Sequence Viewer

Length: 342 bp
ATGTCAAAACATATATCATTGAGTAAATATAGAAGAGACATAAGGAGGGGTTGCATTACAAGGTCTCAAATTTTGCCTTCAGTTCTTGGGGATGCTGATGGGTTACGAGTATTTGTGCTCTCAGATTTGCACATTGACTATACTGAAAACATGAAATGGATCAAGGACTTATCATCCGTCAGATACAAGAATGATATTCTTATTGTTGCTGGTGATGTTTCTGAGACATACAAGAACTTTATAATGACCATGTCTCTCTTGAAGAATAAATTTGAACATGTCCTTTATGTTCCTGGGAACCATGACCTCTGGTGCCGTCGGGAGGGAGAAATTTATCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos

Protein Analysis

114

Amino Acids

13.25

Weight (kDa)

8.93

Isoelectric Point (pI)

57.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallophos PF00149 35 - 103 1.8e-10 Calcineurin-like phosphoesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 242
AccB1I GGYRCC 1 cut(s) 312
AclWI GGATC 1 cut(s) 167
AcsI RAATTY 3 cut(s) 69, 269, 330
AcuI CTGAAG 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 322
AflIII ACRYGT 1 cut(s) 277
AgsI TTSAA 2 cut(s) 262, 275
AjnI CCWGG 1 cut(s) 292
Alw21I GWGCWC 1 cut(s) 120
Alw26I GTCTC 4 cut(s) 30, 69, 218, 258
AlwI GGATC 1 cut(s) 167
ApoI RAATTY 3 cut(s) 69, 269, 330
AsuHPI GGTGA 1 cut(s) 224
BanI GGYRCC 1 cut(s) 312
Bbv12I GWGCWC 1 cut(s) 120
BccI CCATC 1 cut(s) 92
BceAI ACGGC 1 cut(s) 300
BciT130I CCWGG 1 cut(s) 294
BcoDI GTCTC 4 cut(s) 30, 69, 218, 258
Bme1390I CCNGG 1 cut(s) 294
BmiI GGNNCC 2 cut(s) 299, 314
BmrFI CCNGG 1 cut(s) 294
BmsI GCATC 1 cut(s) 82
BsaI GGTCTC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 293
Bsc4I CCNNNNNNNGG 1 cut(s) 322
BseBI CCWGG 1 cut(s) 294
BseDI CCNNGG 1 cut(s) 293
BseGI GGATG 2 cut(s) 97, 173
BseLI CCNNNNNNNGG 1 cut(s) 322
BseMII CTCAG 2 cut(s) 135, 213
BshNI GGYRCC 1 cut(s) 312
BsiHKAI GWGCWC 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 322
BsmAI GTCTC 4 cut(s) 30, 69, 218, 258
Bso31I GGTCTC 1 cut(s) 69
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 159
BspCNI CTCAG 2 cut(s) 134, 214
BspLI GGNNCC 2 cut(s) 299, 314
BspPI GGATC 1 cut(s) 167
BspT107I GGYRCC 1 cut(s) 312
BspTNI GGTCTC 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 293
BssMI GATC 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 294
Bst6I CTCTTC 1 cut(s) 28
BstDEI CTNAG 2 cut(s) 121, 222
BstF5I GGATG 2 cut(s) 97, 173
BstKTI GATC 1 cut(s) 162
BstMAI GTCTC 4 cut(s) 30, 69, 218, 258
BstMBI GATC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 294
BstNSI RCATGY 1 cut(s) 281
BstSCI CCNGG 1 cut(s) 292
BtsCI GGATG 2 cut(s) 97, 173
CviAII CATG 4 cut(s) 151, 250, 278, 302
DdeI CTNAG 2 cut(s) 121, 222
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
Eam1104I CTCTTC 1 cut(s) 28
EarI CTCTTC 1 cut(s) 28
Eco31I GGTCTC 1 cut(s) 69
Eco57I CTGAAG 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 292
FaeI CATG 4 cut(s) 154, 253, 281, 305
FatI CATG 4 cut(s) 150, 249, 277, 301
FokI GGATG 2 cut(s) 104, 160
Hin1II CATG 4 cut(s) 154, 253, 281, 305
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 3 cut(s) 124, 182, 223
Hpy188III TCNNGA 2 cut(s) 259, 320
Hpy99I CGWCG 1 cut(s) 321
HpyAV CCTTC 1 cut(s) 87
HpyCH4V TGCA 2 cut(s) 54, 130
HpyF3I CTNAG 2 cut(s) 121, 222
Hsp92II CATG 4 cut(s) 154, 253, 281, 305
Kzo9I GATC 1 cut(s) 159
LpnPI CCDG 4 cut(s) 195, 279, 295, 306
LweI GCATC 1 cut(s) 82
MaeIII GTNAC 1 cut(s) 102
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 2 cut(s) 45, 274
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 3 cut(s) 69, 269, 330
MnlI CCTC 3 cut(s) 39, 316, 317
MspR9I CCNGG 1 cut(s) 294
MvaI CCWGG 1 cut(s) 294
NdeII GATC 1 cut(s) 159
NlaIII CATG 4 cut(s) 154, 253, 281, 305
NlaIV GGNNCC 2 cut(s) 299, 314
NspI RCATGY 1 cut(s) 281
PciI ACATGT 1 cut(s) 277
PflFI GACNNNGTC 1 cut(s) 250
PscI ACATGT 1 cut(s) 277
PsiI TTATAA 1 cut(s) 242
Psp6I CCWGG 1 cut(s) 292
PspGI CCWGG 1 cut(s) 292
PspN4I GGNNCC 2 cut(s) 299, 314
PsyI GACNNNGTC 1 cut(s) 250
Sau3AI GATC 1 cut(s) 159
ScrFI CCNGG 1 cut(s) 294
SduI GDGCHC 1 cut(s) 120
SetI ASST 2 cut(s) 65, 309
SfaNI GCATC 1 cut(s) 82
Sse9I AATT 3 cut(s) 69, 269, 330
StyD4I CCNGG 1 cut(s) 292
TasI AATT 3 cut(s) 69, 269, 330
TspDTI ATGAA 1 cut(s) 167
TspGWI ACGGA 1 cut(s) 166
Tth111I GACNNNGTC 1 cut(s) 250
XapI RAATTY 3 cut(s) 69, 269, 330
XceI RCATGY 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.