Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002436.1

Orthogroup ID

OG0003480

Physical Location & Seq

Genomic Coordinates Forward (+)

798 .. 2708

Gene Structure 1911 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002436.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 363 bp

atgctattctatccgaagcttccaaagattattggctctgattgtcttgaggtccgtataaggtccatccatggggttgaaggaagtgcatctgcatgtcatgtgtttggtcatacacatttctgctgggatgctgtgcttgatggtatcaggtatgtgcaggctccattagcttacccaagggaacggaagaggagaatgaatgggggtgaaaattggttgccattttgtatctattctaatggaaagttgtctgataggctttcgccgtgttattggtctgattattactcttccaacccaagaacacctcataacactaaacttgccccgtgggttgccaggttttataaccaaacgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Metallophos

Protein Analysis

120

Amino Acids

13.9

Weight (kDa)

9.22

Isoelectric Point (pI)

40.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003480)

Species	Orthologous Gene IDs
malus_domestica	MD06G1241600.v1.1
prunus_persica	Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1
pyrus_communis	pycom06g21670 pycom06g21680
rosa_chinensis	RchiOBHm_Chr7g0176861
rosa_laevigata	RLG00000005578 RLG00000012575
rosa_multiflora	Rmu_sc0002436.1_g000001 Rmu_sc0005162.1_g000012 Rmu_sc0011812.1_g000003
rosa_roxburghii	Rroxscaffold_3G00276330
rosa_samantha	Rh6BG195100 Rh7AG000600 Rh7BG001000 Rh7CG000600 Rh7DG000800
rosa_wichuraiana	Rw7G000050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	351
AfiI	CCNNNNNNNGG	1 cut(s)	72
AgsI	TTSAA	1 cut(s)	80
AjnI	CCWGG	1 cut(s)	341
AluBI	AGCT	2 cut(s)	19, 173
AluI	AGCT	2 cut(s)	19, 173
AspS9I	GGNCC	2 cut(s)	52, 63
AsuHPI	GGTGA	1 cut(s)	221
AvaII	GGWCC	2 cut(s)	52, 63
BccI	CCATC	2 cut(s)	74, 137
BceAI	ACGGC	1 cut(s)	253
BciT130I	CCWGG	1 cut(s)	343
Bme1390I	CCNGG	1 cut(s)	343
Bme18I	GGWCC	2 cut(s)	52, 63
BmgT120I	GGNCC	2 cut(s)	52, 63
BmiI	GGNNCC	1 cut(s)	165
BmrFI	CCNGG	1 cut(s)	343
BmsI	GCATC	2 cut(s)	98, 121
BpuEI	CTTGAG	1 cut(s)	68
BsaJI	CCNNGG	3 cut(s)	70, 179, 332
Bsc4I	CCNNNNNNNGG	1 cut(s)	72
BseBI	CCWGG	1 cut(s)	343
BseDI	CCNNGG	3 cut(s)	70, 179, 332
BseGI	GGATG	2 cut(s)	66, 136
BseLI	CCNNNNNNNGG	1 cut(s)	72
BseRI	GAGGAG	1 cut(s)	208
BseYI	CCCAGC	1 cut(s)	126
BsgI	GTGCAG	1 cut(s)	179
BslI	CCNNNNNNNGG	1 cut(s)	72
Bsp19I	CCATGG	1 cut(s)	70
BspLI	GGNNCC	1 cut(s)	165
BssECI	CCNNGG	3 cut(s)	70, 179, 332
BssT1I	CCWWGG	2 cut(s)	70, 179
Bst2UI	CCWGG	1 cut(s)	343
Bst6I	CTCTTC	2 cut(s)	185, 298
BstC8I	GCNNGC	1 cut(s)	162
BstDSI	CCRYGG	2 cut(s)	70, 332
BstF5I	GGATG	2 cut(s)	66, 136
BstMWI	GCNNNNNNNGC	1 cut(s)	170
BstNI	CCWGG	1 cut(s)	343
BstNSI	RCATGY	1 cut(s)	99
BstSCI	CCNGG	1 cut(s)	341
BtgI	CCRYGG	2 cut(s)	70, 332
BtsCI	GGATG	2 cut(s)	66, 136
Cac8I	GCNNGC	1 cut(s)	162
Cfr13I	GGNCC	2 cut(s)	52, 63
CviAII	CATG	3 cut(s)	71, 96, 101
CviJI	RGCY	5 cut(s)	19, 36, 164, 173, 262
CviKI_1	RGCY	5 cut(s)	19, 36, 164, 173, 262
Eam1104I	CTCTTC	2 cut(s)	185, 298
EarI	CTCTTC	2 cut(s)	185, 298
Eco130I	CCWWGG	2 cut(s)	70, 179
Eco47I	GGWCC	2 cut(s)	52, 63
EcoRII	CCWGG	1 cut(s)	341
EcoT14I	CCWWGG	2 cut(s)	70, 179
ErhI	CCWWGG	2 cut(s)	70, 179
FaeI	CATG	3 cut(s)	74, 99, 104
FaiI	YATR	8 cut(s)	59, 72, 97, 102, 114, 156, 315, 351
FatI	CATG	3 cut(s)	70, 95, 100
FokI	GGATG	2 cut(s)	53, 143
GsaI	CCCAGC	1 cut(s)	130
Hin1II	CATG	3 cut(s)	74, 99, 104
HindIII	AAGCTT	1 cut(s)	17
HphI	GGTGA	1 cut(s)	221
Hpy188I	TCNGA	4 cut(s)	15, 40, 256, 283
Hpy188III	TCNNGA	1 cut(s)	47
HpyAV	CCTTC	1 cut(s)	74
HpyCH4IV	ACGT	1 cut(s)	359
HpyCH4V	TGCA	3 cut(s)	89, 95, 160
HpyF10VI	GCNNNNNNNGC	1 cut(s)	170
HpySE526I	ACGT	1 cut(s)	359
Hsp92II	CATG	3 cut(s)	74, 99, 104
LmnI	GCTCC	1 cut(s)	169
LpnPI	CCDG	5 cut(s)	112, 136, 146, 328, 355
LweI	GCATC	2 cut(s)	98, 121
MaeII	ACGT	1 cut(s)	359
MboII	GAAGA	2 cut(s)	202, 285
MluCI	AATT	1 cut(s)	214
MmeI	TCCRAC	1 cut(s)	321
MnlI	CCTC	3 cut(s)	43, 186, 321
MslI	CAYNNNNRTG	1 cut(s)	94
MspR9I	CCNGG	1 cut(s)	343
MvaI	CCWGG	1 cut(s)	343
MwoI	GCNNNNNNNGC	1 cut(s)	170
NcoI	CCATGG	1 cut(s)	70
NlaIII	CATG	3 cut(s)	74, 99, 104
NlaIV	GGNNCC	1 cut(s)	165
NspI	RCATGY	1 cut(s)	99
PsiI	TTATAA	1 cut(s)	351
Psp6I	CCWGG	1 cut(s)	341
PspFI	CCCAGC	1 cut(s)	126
PspGI	CCWGG	1 cut(s)	341
PspN4I	GGNNCC	1 cut(s)	165
PspPI	GGNCC	2 cut(s)	52, 63
RseI	CAYNNNNRTG	1 cut(s)	94
Sau96I	GGNCC	2 cut(s)	52, 63
ScrFI	CCNGG	1 cut(s)	343
SetI	ASST	8 cut(s)	21, 54, 65, 155, 175, 313, 347, 362
SfaNI	GCATC	2 cut(s)	98, 121
SinI	GGWCC	2 cut(s)	52, 63
SmiMI	CAYNNNNRTG	1 cut(s)	94
SmlI	CTYRAG	1 cut(s)	47
SmoI	CTYRAG	1 cut(s)	47
Sse9I	AATT	1 cut(s)	214
StyD4I	CCNGG	1 cut(s)	341
StyI	CCWWGG	2 cut(s)	70, 179
TaiI	ACGT	1 cut(s)	362
TasI	AATT	1 cut(s)	214
TspDTI	ATGAA	1 cut(s)	215
TspGWI	ACGGA	2 cut(s)	44, 202
VpaK11BI	GGWCC	2 cut(s)	52, 63
XceI	RCATGY	1 cut(s)	99

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.