Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011812.1

Orthogroup ID

OG0003480

Physical Location & Seq

Genomic Coordinates Reverse (-)

13354 .. 13863

Gene Structure 510 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011812.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 510 bp

atgctctgcattttcactgtacacatggtaccaagtgttgccgtatcttgcttgagcttatcgcaatatgcttatcattcaaaccacatgtcaaaacatatatcattgagtaaatatagaagagacataaggaggggttgcattacaaggtctcaaattttgccttcagttcttggggatgctgatgggttacgagtatttgtgctctcagatttgcacactgactatactgaaaacttgaactggatcaaggacttatcatccgtcagatacaagaatgatattcttattgttgctggtgatgtttctgagacatacaagaactttataatgaccatgtctctcttgaagaataaatttgaacatgtcctttatgttcctgggaaccatgacctctggtgccgtcgggagggagaaatttatgtgagcaatgctatttatttgccaggccgttatagtgcttgtactatatcctcccagtgcagtatttctcatcacttagcatcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Metallophos

Protein Analysis

169

Amino Acids

19.26

Weight (kDa)

8.52

Isoelectric Point (pI)

53.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003480)

Species	Orthologous Gene IDs
malus_domestica	MD06G1241600.v1.1
prunus_persica	Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1 Prupe.5G246200_v2.0.a1
pyrus_communis	pycom06g21670 pycom06g21680
rosa_chinensis	RchiOBHm_Chr7g0176861
rosa_laevigata	RLG00000005578 RLG00000012575
rosa_multiflora	Rmu_sc0002436.1_g000001 Rmu_sc0005162.1_g000012 Rmu_sc0011812.1_g000003
rosa_roxburghii	Rroxscaffold_3G00276330
rosa_samantha	Rh6BG195100 Rh7AG000600 Rh7BG001000 Rh7CG000600 Rh7DG000800
rosa_wichuraiana	Rw7G000050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	329
Acc65I	GGTACC	1 cut(s)	28
AccB1I	GGYRCC	2 cut(s)	28, 399
AclWI	GGATC	1 cut(s)	254
AcsI	RAATTY	3 cut(s)	156, 356, 417
AcuI	CTGAAG	1 cut(s)	150
AfaI	GTAC	3 cut(s)	21, 30, 466
AfiI	CCNNNNNNNGG	1 cut(s)	409
AflIII	ACRYGT	2 cut(s)	87, 364
AgsI	TTSAA	4 cut(s)	81, 241, 349, 362
AjnI	CCWGG	2 cut(s)	379, 445
AluBI	AGCT	1 cut(s)	57
AluI	AGCT	1 cut(s)	57
Alw21I	GWGCWC	1 cut(s)	207
Alw26I	GTCTC	4 cut(s)	117, 156, 305, 345
AlwI	GGATC	1 cut(s)	254
AoxI	GGCC	1 cut(s)	448
ApoI	RAATTY	3 cut(s)	156, 356, 417
ArsI	GACNNNNNNTTYG	2 cut(s)	74, 106
Asp718I	GGTACC	1 cut(s)	28
AsuHPI	GGTGA	1 cut(s)	311
BanI	GGYRCC	2 cut(s)	28, 399
Bbv12I	GWGCWC	1 cut(s)	207
BccI	CCATC	1 cut(s)	179
BceAI	ACGGC	3 cut(s)	26, 387, 435
BciT130I	CCWGG	2 cut(s)	381, 447
BcoDI	GTCTC	4 cut(s)	117, 156, 305, 345
Bme1390I	CCNGG	2 cut(s)	381, 447
BmiI	GGNNCC	3 cut(s)	30, 386, 401
BmrFI	CCNGG	2 cut(s)	381, 447
BmrI	ACTGGG	1 cut(s)	472
BmsI	GCATC	1 cut(s)	169
BmuI	ACTGGG	1 cut(s)	472
BpuEI	CTTGAG	1 cut(s)	73
BsaI	GGTCTC	1 cut(s)	156
BsaJI	CCNNGG	1 cut(s)	380
Bsc4I	CCNNNNNNNGG	1 cut(s)	409
Bse1I	ACTGG	2 cut(s)	248, 478
Bse3DI	GCAATG	1 cut(s)	436
BseBI	CCWGG	2 cut(s)	381, 447
BseDI	CCNNGG	1 cut(s)	380
BseGI	GGATG	2 cut(s)	184, 260
BseLI	CCNNNNNNNGG	1 cut(s)	409
BseMI	GCAATG	1 cut(s)	436
BseMII	CTCAG	2 cut(s)	222, 300
BseNI	ACTGG	2 cut(s)	248, 478
BsgI	GTGCAG	1 cut(s)	502
BshFI	GGCC	1 cut(s)	450
BshNI	GGYRCC	2 cut(s)	28, 399
BsiHKAI	GWGCWC	1 cut(s)	207
BslI	CCNNNNNNNGG	1 cut(s)	409
BsmAI	GTCTC	4 cut(s)	117, 156, 305, 345
BsnI	GGCC	1 cut(s)	450
Bso31I	GGTCTC	1 cut(s)	156
Bsp1286I	GDGCHC	1 cut(s)	207
Bsp1407I	TGTACA	1 cut(s)	19
Bsp143I	GATC	1 cut(s)	246
BspANI	GGCC	1 cut(s)	450
BspCNI	CTCAG	2 cut(s)	221, 301
BspLI	GGNNCC	3 cut(s)	30, 386, 401
BspPI	GGATC	1 cut(s)	254
BspT107I	GGYRCC	2 cut(s)	28, 399
BspTNI	GGTCTC	1 cut(s)	156
BsrDI	GCAATG	1 cut(s)	436
BsrGI	TGTACA	1 cut(s)	19
BsrI	ACTGG	2 cut(s)	248, 478
BssECI	CCNNGG	1 cut(s)	380
BssMI	GATC	1 cut(s)	246
Bst2UI	CCWGG	2 cut(s)	381, 447
Bst4CI	ACNGT	1 cut(s)	19
Bst6I	CTCTTC	1 cut(s)	115
BstAUI	TGTACA	1 cut(s)	19
BstDEI	CTNAG	3 cut(s)	208, 309, 499
BstF5I	GGATG	2 cut(s)	184, 260
BstKTI	GATC	1 cut(s)	249
BstMAI	GTCTC	4 cut(s)	117, 156, 305, 345
BstMBI	GATC	1 cut(s)	246
BstNI	CCWGG	2 cut(s)	381, 447
BstNSI	RCATGY	2 cut(s)	91, 368
BstSCI	CCNGG	2 cut(s)	379, 445
BsuRI	GGCC	1 cut(s)	450
BtsCI	GGATG	2 cut(s)	184, 260
BtsIMutI	CAGTG	3 cut(s)	15, 219, 485
Csp6I	GTAC	3 cut(s)	20, 29, 465
CviAII	CATG	5 cut(s)	25, 88, 337, 365, 389
CviJI	RGCY	2 cut(s)	57, 450
CviKI_1	RGCY	2 cut(s)	57, 450
CviQI	GTAC	3 cut(s)	20, 29, 465
DdeI	CTNAG	3 cut(s)	208, 309, 499
DpnI	GATC	1 cut(s)	248
DpnII	GATC	1 cut(s)	246
Eam1104I	CTCTTC	1 cut(s)	115
EarI	CTCTTC	1 cut(s)	115
Eco31I	GGTCTC	1 cut(s)	156
Eco57I	CTGAAG	1 cut(s)	150
EcoRII	CCWGG	2 cut(s)	379, 445
FaeI	CATG	5 cut(s)	28, 91, 340, 368, 392
FatI	CATG	5 cut(s)	24, 87, 336, 364, 388
FokI	GGATG	2 cut(s)	191, 247
HaeIII	GGCC	1 cut(s)	450
Hin1II	CATG	5 cut(s)	28, 91, 340, 368, 392
HphI	GGTGA	1 cut(s)	311
Hpy166II	GTNNAC	1 cut(s)	22
Hpy188I	TCNGA	3 cut(s)	211, 269, 310
Hpy188III	TCNNGA	2 cut(s)	346, 407
Hpy8I	GTNNAC	1 cut(s)	22
Hpy99I	CGWCG	1 cut(s)	408
HpyAV	CCTTC	1 cut(s)	174
HpyCH4III	ACNGT	1 cut(s)	19
HpyCH4V	TGCA	4 cut(s)	9, 141, 217, 483
HpyF3I	CTNAG	3 cut(s)	208, 309, 499
Hsp92II	CATG	5 cut(s)	28, 91, 340, 368, 392
KpnI	GGTACC	1 cut(s)	32
Kzo9I	GATC	1 cut(s)	246
LpnPI	CCDG	8 cut(s)	229, 282, 366, 382, 393, 432, 459, 491
LweI	GCATC	1 cut(s)	169
MaeIII	GTNAC	1 cut(s)	189
MalI	GATC	1 cut(s)	248
MboI	GATC	1 cut(s)	246
MboII	GAAGA	2 cut(s)	132, 361
MhlI	GDGCHC	1 cut(s)	207
MluCI	AATT	3 cut(s)	156, 356, 417
MnlI	CCTC	4 cut(s)	126, 403, 404, 484
MseI	TTAA	1 cut(s)	508
MspR9I	CCNGG	2 cut(s)	381, 447
MvaI	CCWGG	2 cut(s)	381, 447
NdeII	GATC	1 cut(s)	246
NlaIII	CATG	5 cut(s)	28, 91, 340, 368, 392
NlaIV	GGNNCC	3 cut(s)	30, 386, 401
NspI	RCATGY	2 cut(s)	91, 368
PciI	ACATGT	2 cut(s)	87, 364
PflFI	GACNNNGTC	1 cut(s)	337
PscI	ACATGT	2 cut(s)	87, 364
PsiI	TTATAA	1 cut(s)	329
Psp6I	CCWGG	2 cut(s)	379, 445
PspGI	CCWGG	2 cut(s)	379, 445
PspN4I	GGNNCC	3 cut(s)	30, 386, 401
PsyI	GACNNNGTC	1 cut(s)	337
RsaI	GTAC	3 cut(s)	21, 30, 466
RsaNI	GTAC	3 cut(s)	20, 29, 465
SaqAI	TTAA	1 cut(s)	508
Sau3AI	GATC	1 cut(s)	246
ScrFI	CCNGG	2 cut(s)	381, 447
SduI	GDGCHC	1 cut(s)	207
SetI	ASST	3 cut(s)	59, 152, 396
SfaNI	GCATC	1 cut(s)	169
SmlI	CTYRAG	1 cut(s)	52
SmoI	CTYRAG	1 cut(s)	52
Sse9I	AATT	3 cut(s)	156, 356, 417
StyD4I	CCNGG	2 cut(s)	379, 445
TaaI	ACNGT	1 cut(s)	19
TasI	AATT	3 cut(s)	156, 356, 417
TatI	WGTACW	2 cut(s)	19, 464
Tru1I	TTAA	1 cut(s)	508
Tru9I	TTAA	1 cut(s)	508
TscAI	CASTG	3 cut(s)	22, 226, 485
TspGWI	ACGGA	1 cut(s)	253
TspRI	CASTG	3 cut(s)	22, 226, 485
Tth111I	GACNNNGTC	1 cut(s)	337
XapI	RAATTY	3 cut(s)	156, 356, 417
XceI	RCATGY	2 cut(s)	91, 368

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.