RLG00000022497

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
2032697 .. 2034387
1691 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022497

Sequence Viewer

Length: 489 bp
ATGTTTTGCAATTGTATATTTACGTGGGTTAAAAATGATCATAAAGACTTAAGGAGATCAATCAGGGAAATTTTGACAGTATACTGTGGCCCACTGGTCAAGTCTCTATCATCAAACATAACAACTGCAATTCGACCCACCTGCTCTCCTGCAAAACATGGTAATGAACAAGGTAGTACTTGGATTTTTGTCCTATCCCAAAATCACTCATCAAGGACACCAGCTCAAGAGGAAGAAGGTCAACAGAACAAGAAACGGTTATTGGTGATGGCTCTGATCACAATTCCTATGATTATGATCCTACTAAGAACAATGATGTATTTTCTAAAAACGAGAGTAGTCAAGTCAATTGGGATTATAGACAACATTAAAAGATCAGTTTATAGGCTATTAAATGTAATTCCAGCAACAGACAGTTTTAACATCAATTCTCCTAATCTGTCTACAAGTTGGAGAGGGTGGTTCATATATGTCTACAAGGAAGGATGA

Protein Analysis

163

Amino Acids

18.66

Weight (kDa)

9.87

Isoelectric Point (pI)

56.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018340)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 149
Acc36I ACCTGC 1 cut(s) 149
AccI GTMKAC 3 cut(s) 81, 443, 474
AclWI GGATC 1 cut(s) 292
AcsI RAATTY 1 cut(s) 69
AfaI GTAC 1 cut(s) 178
AflII CTTAAG 1 cut(s) 49
AjuI GAANNNNNNNTTGG 2 cut(s) 245, 277
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
Alw26I GTCTC 1 cut(s) 108
AlwI GGATC 1 cut(s) 292
AoxI GGCC 1 cut(s) 88
ApoI RAATTY 1 cut(s) 69
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 277
BccI CCATC 1 cut(s) 262
BcgI CGANNNNNNTGC 2 cut(s) 123, 157
BclI TGATCA 2 cut(s) 37, 276
BcoDI GTCTC 1 cut(s) 108
BfrI CTTAAG 1 cut(s) 49
BfuAI ACCTGC 1 cut(s) 149
BmcAI AGTACT 1 cut(s) 178
BmgT120I GGNCC 1 cut(s) 89
BpuEI CTTGAG 1 cut(s) 210
BsaAI YACGTR 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 296
BsaXI ACNNNNNCTCC 2 cut(s) 130, 160
Bse1I ACTGG 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 296
BseJI GATNNNNATC 1 cut(s) 296
BseNI ACTGG 1 cut(s) 99
BshFI GGCC 1 cut(s) 90
BsmAI GTCTC 1 cut(s) 108
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 5 cut(s) 37, 56, 276, 297, 374
BspANI GGCC 1 cut(s) 90
BspMI ACCTGC 1 cut(s) 149
BspPI GGATC 1 cut(s) 292
BspTI CTTAAG 1 cut(s) 49
BsrI ACTGG 1 cut(s) 99
BssMI GATC 5 cut(s) 37, 56, 276, 297, 374
BssNAI GTATAC 1 cut(s) 82
Bst1107I GTATAC 1 cut(s) 82
Bst4CI ACNGT 4 cut(s) 79, 86, 258, 416
BstAFI CTTAAG 1 cut(s) 49
BstBAI YACGTR 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 305
BstKTI GATC 5 cut(s) 40, 59, 279, 300, 377
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 5 cut(s) 37, 56, 276, 297, 374
BstZ17I GTATAC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 92
BveI ACCTGC 1 cut(s) 149
Cfr13I GGNCC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 177
CviAII CATG 1 cut(s) 158
CviJI RGCY 4 cut(s) 90, 224, 272, 388
CviKI_1 RGCY 4 cut(s) 90, 224, 272, 388
CviQI GTAC 1 cut(s) 177
DdeI CTNAG 1 cut(s) 305
DpnI GATC 5 cut(s) 39, 58, 278, 299, 376
DpnII GATC 5 cut(s) 37, 56, 276, 297, 374
FaeI CATG 1 cut(s) 161
FatI CATG 1 cut(s) 157
FbaI TGATCA 2 cut(s) 37, 276
FblI GTMKAC 3 cut(s) 81, 443, 474
HaeIII GGCC 1 cut(s) 90
Hin1II CATG 1 cut(s) 161
HincII GTYRAC 1 cut(s) 242
HindII GTYRAC 1 cut(s) 242
HphI GGTGA 1 cut(s) 277
Hpy166II GTNNAC 4 cut(s) 82, 242, 444, 475
Hpy188I TCNGA 1 cut(s) 276
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 4 cut(s) 82, 242, 444, 475
HpyAV CCTTC 2 cut(s) 230, 476
HpyCH4III ACNGT 4 cut(s) 79, 86, 258, 416
HpyCH4IV ACGT 1 cut(s) 23
HpyCH4V TGCA 3 cut(s) 9, 128, 152
HpyF3I CTNAG 1 cut(s) 305
HpySE526I ACGT 1 cut(s) 23
Hsp92II CATG 1 cut(s) 161
Ksp22I TGATCA 2 cut(s) 37, 276
Kzo9I GATC 5 cut(s) 37, 56, 276, 297, 374
LpnPI CCDG 6 cut(s) 49, 80, 154, 162, 234, 417
MaeII ACGT 1 cut(s) 23
MalI GATC 5 cut(s) 39, 58, 278, 299, 376
MboI GATC 5 cut(s) 37, 56, 276, 297, 374
MboII GAAGA 1 cut(s) 245
MfeI CAATTG 2 cut(s) 10, 348
MluCI AATT 7 cut(s) 10, 69, 129, 282, 348, 399, 427
MmeI TCCRAC 1 cut(s) 431
MnlI CCTC 2 cut(s) 223, 449
MseI TTAA 5 cut(s) 30, 50, 369, 392, 420
MslI CAYNNNNRTG 1 cut(s) 162
MspCI CTTAAG 1 cut(s) 49
MunI CAATTG 2 cut(s) 10, 348
NdeII GATC 5 cut(s) 37, 56, 276, 297, 374
NlaIII CATG 1 cut(s) 161
PaqCI CACCTGC 1 cut(s) 149
Ppu21I YACGTR 1 cut(s) 24
PspPI GGNCC 1 cut(s) 89
RsaI GTAC 1 cut(s) 178
RsaNI GTAC 1 cut(s) 177
RseI CAYNNNNRTG 1 cut(s) 162
SaqAI TTAA 5 cut(s) 30, 50, 369, 392, 420
Sau3AI GATC 5 cut(s) 37, 56, 276, 297, 374
Sau96I GGNCC 1 cut(s) 89
ScaI AGTACT 1 cut(s) 178
SetI ASST 5 cut(s) 26, 143, 175, 226, 241
SmiMI CAYNNNNRTG 1 cut(s) 162
SmlI CTYRAG 2 cut(s) 49, 225
SmoI CTYRAG 2 cut(s) 49, 225
Sse9I AATT 7 cut(s) 10, 69, 129, 282, 348, 399, 427
TaaI ACNGT 4 cut(s) 79, 86, 258, 416
TaiI ACGT 1 cut(s) 26
TaqI TCGA 1 cut(s) 133
TasI AATT 7 cut(s) 10, 69, 129, 282, 348, 399, 427
TatI WGTACW 1 cut(s) 176
Tru1I TTAA 5 cut(s) 30, 50, 369, 392, 420
Tru9I TTAA 5 cut(s) 30, 50, 369, 392, 420
TscAI CASTG 1 cut(s) 99
TspDTI ATGAA 2 cut(s) 180, 454
TspRI CASTG 1 cut(s) 99
Vha464I CTTAAG 1 cut(s) 49
XapI RAATTY 1 cut(s) 69
XmiI GTMKAC 3 cut(s) 81, 443, 474
ZrmI AGTACT 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.