RLG00000033859

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
33309544 .. 33310392
849 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033859

Sequence Viewer

Length: 354 bp
ATGCAACATATTATGAAATTGGTGGAGGCATTATCGGCCACACTTAAAAACAAGCCAATATACTGTGGCCCACTGGTCAAGTCTCTATCATCAAACATAACAACTGCAATTCGACCCACCTGCTCTCCTGCAAAAGATGGTAATGAACAAGGTAGTACTTGGATTTTTGTCCTATCCCAAAATCACTCATCAAGGACACCAGGTAGCTCAAGAGGAAGAAGGTCAACAGAACAAGAAACGGTTATTGGTGATTGCTCTGATCACAATTCCTATGATTATGATCCTACTAAGAACAATGATGTATTTTCTAAAAACGAGAGTAGTCAAGTCAATTGGGATTATAGACAACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.09

Weight (kDa)

7.75

Isoelectric Point (pI)

55.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018340)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 128
Acc36I ACCTGC 1 cut(s) 128
AclWI GGATC 1 cut(s) 275
AcoI YGGCCR 1 cut(s) 36
AfaI GTAC 1 cut(s) 157
AjnI CCWGG 1 cut(s) 199
AjuI GAANNNNNNNTTGG 2 cut(s) 228, 260
AluBI AGCT 1 cut(s) 207
AluI AGCT 1 cut(s) 207
Alw26I GTCTC 1 cut(s) 87
AlwI GGATC 1 cut(s) 275
AoxI GGCC 2 cut(s) 36, 67
AspS9I GGNCC 1 cut(s) 68
AsuHPI GGTGA 1 cut(s) 260
BccI CCATC 1 cut(s) 131
BcgI CGANNNNNNTGC 2 cut(s) 102, 136
BciT130I CCWGG 1 cut(s) 201
BclI TGATCA 1 cut(s) 259
BcoDI GTCTC 1 cut(s) 87
BfuAI ACCTGC 1 cut(s) 128
BmcAI AGTACT 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 68
BmrFI CCNGG 1 cut(s) 201
BpuEI CTTGAG 1 cut(s) 193
BsaBI GATNNNNATC 1 cut(s) 279
BsaXI ACNNNNNCTCC 2 cut(s) 109, 139
Bse1I ACTGG 1 cut(s) 78
Bse8I GATNNNNATC 1 cut(s) 279
BseBI CCWGG 1 cut(s) 201
BseJI GATNNNNATC 1 cut(s) 279
BseNI ACTGG 1 cut(s) 78
BshFI GGCC 2 cut(s) 38, 69
BsmAI GTCTC 1 cut(s) 87
BsnI GGCC 2 cut(s) 38, 69
Bsp143I GATC 2 cut(s) 259, 280
BspANI GGCC 2 cut(s) 38, 69
BspMI ACCTGC 1 cut(s) 128
BspPI GGATC 1 cut(s) 275
BsrI ACTGG 1 cut(s) 78
BssMI GATC 2 cut(s) 259, 280
Bst2UI CCWGG 1 cut(s) 201
Bst4CI ACNGT 2 cut(s) 65, 241
BstDEI CTNAG 1 cut(s) 288
BstKTI GATC 2 cut(s) 262, 283
BstMAI GTCTC 1 cut(s) 87
BstMBI GATC 2 cut(s) 259, 280
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
BsuRI GGCC 2 cut(s) 38, 69
BtsIMutI CAGTG 1 cut(s) 71
BveI ACCTGC 1 cut(s) 128
Cfr13I GGNCC 1 cut(s) 68
CsiI ACCWGGT 1 cut(s) 199
Csp6I GTAC 1 cut(s) 156
CviJI RGCY 4 cut(s) 38, 55, 69, 207
CviKI_1 RGCY 4 cut(s) 38, 55, 69, 207
CviQI GTAC 1 cut(s) 156
DdeI CTNAG 1 cut(s) 288
DpnI GATC 2 cut(s) 261, 282
DpnII GATC 2 cut(s) 259, 280
EaeI YGGCCR 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 199
FaiI YATR 7 cut(s) 9, 14, 61, 98, 273, 279, 342
FbaI TGATCA 1 cut(s) 259
HaeIII GGCC 2 cut(s) 38, 69
HincII GTYRAC 1 cut(s) 225
HindII GTYRAC 1 cut(s) 225
HphI GGTGA 1 cut(s) 260
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 259
Hpy188III TCNNGA 1 cut(s) 210
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 1 cut(s) 213
HpyCH4III ACNGT 2 cut(s) 65, 241
HpyCH4V TGCA 3 cut(s) 4, 107, 131
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 288
Ksp22I TGATCA 1 cut(s) 259
Kzo9I GATC 2 cut(s) 259, 280
LpnPI CCDG 5 cut(s) 59, 133, 141, 186, 213
MabI ACCWGGT 1 cut(s) 199
MalI GATC 2 cut(s) 261, 282
MboI GATC 2 cut(s) 259, 280
MboII GAAGA 1 cut(s) 228
MfeI CAATTG 1 cut(s) 331
MluCI AATT 4 cut(s) 17, 108, 265, 331
MnlI CCTC 2 cut(s) 19, 206
MseI TTAA 2 cut(s) 45, 352
MspR9I CCNGG 1 cut(s) 201
MunI CAATTG 1 cut(s) 331
MvaI CCWGG 1 cut(s) 201
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 259, 280
PaqCI CACCTGC 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
PspPI GGNCC 1 cut(s) 68
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
SaqAI TTAA 2 cut(s) 45, 352
Sau3AI GATC 2 cut(s) 259, 280
Sau96I GGNCC 1 cut(s) 68
ScaI AGTACT 1 cut(s) 157
ScrFI CCNGG 1 cut(s) 201
SetI ASST 5 cut(s) 122, 154, 205, 209, 224
SexAI ACCWGGT 1 cut(s) 199
SmlI CTYRAG 1 cut(s) 208
SmoI CTYRAG 1 cut(s) 208
Sse9I AATT 4 cut(s) 17, 108, 265, 331
StyD4I CCNGG 1 cut(s) 199
TaaI ACNGT 2 cut(s) 65, 241
TaqI TCGA 1 cut(s) 112
TasI AATT 4 cut(s) 17, 108, 265, 331
TatI WGTACW 1 cut(s) 155
Tru1I TTAA 2 cut(s) 45, 352
Tru9I TTAA 2 cut(s) 45, 352
TscAI CASTG 1 cut(s) 78
TspDTI ATGAA 2 cut(s) 29, 159
TspRI CASTG 1 cut(s) 78
ZrmI AGTACT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.