Rw1G010230

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
22887241 .. 22888998
1758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G010230.1

Sequence Viewer

Length: 276 bp
ATGTGGAGTGAACGCTGGTGGGTTAAAAATGATCATAAAGACTTAAGGAGATCAATCAGGGAAATTTTGACAGTAAATACAGTATACTGTGGCCCACTGGTCAAGTCTCTATCAGCAAACATAACAACTGCAATTCGACCCACCTGCTCTCCTGCAAAAGATCGTAATGAACAAGGTAGTACTTGGATTTTTGTCCTATCCCAAAATCACTCATCAAGGACACCAGCTCAAGAGGAAGAAGGTCAACAGAACAAGAAACGGAAGGATGAGACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.58

Weight (kDa)

9.39

Isoelectric Point (pI)

75.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018340)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 152
Acc36I ACCTGC 1 cut(s) 152
AccI GTMKAC 1 cut(s) 84
AcsI RAATTY 1 cut(s) 63
AfaI GTAC 1 cut(s) 181
AflII CTTAAG 1 cut(s) 43
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
Alw26I GTCTC 2 cut(s) 111, 263
AoxI GGCC 1 cut(s) 91
ApoI RAATTY 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 92
BcgI CGANNNNNNTGC 2 cut(s) 126, 160
BclI TGATCA 1 cut(s) 31
BcoDI GTCTC 2 cut(s) 111, 263
BfaI CTAG 1 cut(s) 274
BfrI CTTAAG 1 cut(s) 43
BfuAI ACCTGC 1 cut(s) 152
BmcAI AGTACT 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 92
BpuEI CTTGAG 1 cut(s) 213
BsaI GGTCTC 1 cut(s) 263
BsaXI ACNNNNNCTCC 2 cut(s) 133, 163
Bse1I ACTGG 1 cut(s) 102
BseGI GGATG 1 cut(s) 271
BseNI ACTGG 1 cut(s) 102
BshFI GGCC 1 cut(s) 93
BsmAI GTCTC 2 cut(s) 111, 263
BsnI GGCC 1 cut(s) 93
Bso31I GGTCTC 1 cut(s) 263
Bsp143I GATC 3 cut(s) 31, 50, 160
BspANI GGCC 1 cut(s) 93
BspMI ACCTGC 1 cut(s) 152
BspTI CTTAAG 1 cut(s) 43
BspTNI GGTCTC 1 cut(s) 263
BsrI ACTGG 1 cut(s) 102
BssMI GATC 3 cut(s) 31, 50, 160
BssNAI GTATAC 1 cut(s) 85
Bst1107I GTATAC 1 cut(s) 85
Bst4CI ACNGT 3 cut(s) 73, 82, 89
BstAFI CTTAAG 1 cut(s) 43
BstF5I GGATG 1 cut(s) 271
BstKTI GATC 3 cut(s) 34, 53, 163
BstMAI GTCTC 2 cut(s) 111, 263
BstMBI GATC 3 cut(s) 31, 50, 160
BstZ17I GTATAC 1 cut(s) 85
BsuRI GGCC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 271
BtsIMutI CAGTG 1 cut(s) 95
BveI ACCTGC 1 cut(s) 152
Cfr13I GGNCC 1 cut(s) 92
Csp6I GTAC 1 cut(s) 180
CviJI RGCY 2 cut(s) 93, 227
CviKI_1 RGCY 2 cut(s) 93, 227
CviQI GTAC 1 cut(s) 180
DpnI GATC 3 cut(s) 33, 52, 162
DpnII GATC 3 cut(s) 31, 50, 160
Eco31I GGTCTC 1 cut(s) 263
FaiI YATR 3 cut(s) 36, 85, 122
FbaI TGATCA 1 cut(s) 31
FblI GTMKAC 1 cut(s) 84
FspBI CTAG 1 cut(s) 274
HaeIII GGCC 1 cut(s) 93
HincII GTYRAC 1 cut(s) 245
HindII GTYRAC 1 cut(s) 245
Hpy166II GTNNAC 3 cut(s) 11, 85, 245
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 3 cut(s) 11, 85, 245
HpyAV CCTTC 2 cut(s) 233, 256
HpyCH4III ACNGT 3 cut(s) 73, 82, 89
HpyCH4V TGCA 2 cut(s) 131, 155
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 3 cut(s) 31, 50, 160
LpnPI CCDG 5 cut(s) 43, 83, 157, 165, 237
MaeI CTAG 1 cut(s) 274
MalI GATC 3 cut(s) 33, 52, 162
MboI GATC 3 cut(s) 31, 50, 160
MboII GAAGA 1 cut(s) 248
MluCI AATT 2 cut(s) 63, 132
MnlI CCTC 1 cut(s) 226
MseI TTAA 2 cut(s) 24, 44
MspCI CTTAAG 1 cut(s) 43
NdeII GATC 3 cut(s) 31, 50, 160
PaqCI CACCTGC 1 cut(s) 152
PspPI GGNCC 1 cut(s) 92
RsaI GTAC 1 cut(s) 181
RsaNI GTAC 1 cut(s) 180
SaqAI TTAA 2 cut(s) 24, 44
Sau3AI GATC 3 cut(s) 31, 50, 160
Sau96I GGNCC 1 cut(s) 92
ScaI AGTACT 1 cut(s) 181
SetI ASST 5 cut(s) 146, 178, 229, 244, 275
SmlI CTYRAG 2 cut(s) 43, 228
SmoI CTYRAG 2 cut(s) 43, 228
Sse9I AATT 2 cut(s) 63, 132
SspMI CTAG 1 cut(s) 274
TaaI ACNGT 3 cut(s) 73, 82, 89
TaqI TCGA 1 cut(s) 136
TasI AATT 2 cut(s) 63, 132
TatI WGTACW 1 cut(s) 179
Tru1I TTAA 2 cut(s) 24, 44
Tru9I TTAA 2 cut(s) 24, 44
TscAI CASTG 1 cut(s) 102
TspDTI ATGAA 1 cut(s) 183
TspGWI ACGGA 1 cut(s) 274
TspRI CASTG 1 cut(s) 102
Vha464I CTTAAG 1 cut(s) 43
XapI RAATTY 1 cut(s) 63
XmiI GTMKAC 1 cut(s) 84
XspI CTAG 1 cut(s) 274
ZrmI AGTACT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.