Rroxscaffold_6G00416200

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
38243377 .. 38247814
4438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00416200.1

Sequence Viewer

Length: 201 bp
ATGTTTAATTTTGATAAGAAGATAGGTCACCAATATGTTTACTTTGACAGCTCAAGAGGAAGAAGGTCAATAGAACAAGAAACGGTTATTGGTGATTGCTCTGATCACAATTTCTATGATTATGATCCTACTGAGAACAATGATGTATTATCTAAAAAAGGAGAGTACTCAAGTCAATTTGTAATCTTCTTAAACTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.8

Weight (kDa)

4.85

Isoelectric Point (pI)

59.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018340)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 119
AfaI GTAC 1 cut(s) 167
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
AluBI AGCT 1 cut(s) 51
AluI AGCT 1 cut(s) 51
AlwI GGATC 1 cut(s) 119
AsuHPI GGTGA 2 cut(s) 20, 104
BclI TGATCA 1 cut(s) 103
BmcAI AGTACT 1 cut(s) 167
BpuEI CTTGAG 2 cut(s) 37, 154
BsaBI GATNNNNATC 1 cut(s) 123
Bse8I GATNNNNATC 1 cut(s) 123
BseJI GATNNNNATC 1 cut(s) 123
BseMII CTCAG 1 cut(s) 123
Bsp143I GATC 2 cut(s) 103, 124
BspCNI CTCAG 1 cut(s) 124
BspPI GGATC 1 cut(s) 119
BssMI GATC 2 cut(s) 103, 124
Bst4CI ACNGT 2 cut(s) 85, 197
BstDEI CTNAG 1 cut(s) 132
BstEII GGTNACC 1 cut(s) 26
BstKTI GATC 2 cut(s) 106, 127
BstMBI GATC 2 cut(s) 103, 124
BstPI GGTNACC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 166
CviJI RGCY 1 cut(s) 51
CviKI_1 RGCY 1 cut(s) 51
CviQI GTAC 1 cut(s) 166
DdeI CTNAG 1 cut(s) 132
DpnI GATC 2 cut(s) 105, 126
DpnII GATC 2 cut(s) 103, 124
Eco91I GGTNACC 1 cut(s) 26
EcoO65I GGTNACC 1 cut(s) 26
FaiI YATR 3 cut(s) 36, 117, 123
FbaI TGATCA 1 cut(s) 103
FspEI CC 8 cut(s) 9, 42, 44, 49, 68, 75, 141, 144
HphI GGTGA 2 cut(s) 20, 104
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 54
Hpy8I GTNNAC 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 57
HpyCH4III ACNGT 2 cut(s) 85, 197
HpyF3I CTNAG 1 cut(s) 132
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 2 cut(s) 103, 124
MaeIII GTNAC 1 cut(s) 26
MalI GATC 2 cut(s) 105, 126
MboI GATC 2 cut(s) 103, 124
MboII GAAGA 3 cut(s) 31, 72, 178
MluCI AATT 3 cut(s) 7, 109, 176
MnlI CCTC 1 cut(s) 50
MseI TTAA 3 cut(s) 6, 191, 199
MslI CAYNNNNRTG 1 cut(s) 33
NdeII GATC 2 cut(s) 103, 124
NmuCI GTSAC 1 cut(s) 26
PspEI GGTNACC 1 cut(s) 26
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
RseI CAYNNNNRTG 1 cut(s) 33
SaqAI TTAA 3 cut(s) 6, 191, 199
Sau3AI GATC 2 cut(s) 103, 124
ScaI AGTACT 1 cut(s) 167
SetI ASST 3 cut(s) 28, 53, 68
SgeI CNNG 3 cut(s) 66, 89, 183
SmiMI CAYNNNNRTG 1 cut(s) 33
SmlI CTYRAG 2 cut(s) 52, 169
SmoI CTYRAG 2 cut(s) 52, 169
Sse9I AATT 3 cut(s) 7, 109, 176
TaaI ACNGT 2 cut(s) 85, 197
TasI AATT 3 cut(s) 7, 109, 176
TatI WGTACW 1 cut(s) 165
Tru1I TTAA 3 cut(s) 6, 191, 199
Tru9I TTAA 3 cut(s) 6, 191, 199
TseFI GTSAC 1 cut(s) 26
Tsp45I GTSAC 1 cut(s) 26
ZrmI AGTACT 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.