RLG00000023056

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
17443675 .. 17444460
786 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000023056

Sequence Viewer

Length: 327 bp
ATGACCATGATATTTGCAGTTACTAGTGTGTATTTGAGAAGAATCCAGTTCATTTATGAATCAAAAGAGGTGTATGAAAGAGAATCCAGTTCGTATCCCAGCTACTTGGTTGCATTAGCTGATTCTCCAAATGAGGCCCTTCCTCTTAATTGCAGACCAAATATTGGTGCTGCACAGTTGACCAAAGATAAATTCAAGAAGAAGGCAGCAAAACTAACTCAGGAGTATACTACTTCTGCCAATGAGGTTGCACAAGAGACATTCCCTTTGGTGAATGTACCAGTTTCATCTCAACAGAAAATTGAAGCTTCAGATGTGTTCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.15

Weight (kDa)

6.26

Isoelectric Point (pI)

48.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 164
AccI GTMKAC 1 cut(s) 227
AcsI RAATTY 1 cut(s) 191
AcuI CTGAAG 1 cut(s) 294
AfaI GTAC 1 cut(s) 279
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 196, 305
AhlI ACTAGT 1 cut(s) 23
AjuI GAANNNNNNNTTGG 2 cut(s) 176, 208
AluBI AGCT 3 cut(s) 102, 119, 308
AluI AGCT 3 cut(s) 102, 119, 308
Alw26I GTCTC 1 cut(s) 251
AoxI GGCC 1 cut(s) 135
ApeKI GCWGC 2 cut(s) 170, 206
ApoI RAATTY 1 cut(s) 191
ArsI GACNNNNNNTTYG 2 cut(s) 250, 282
AspS9I GGNCC 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 283
BbvI GCAGC 2 cut(s) 157, 218
BciVI GTATCC 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 251
BcuI ACTAGT 1 cut(s) 23
BfaI CTAG 1 cut(s) 24
BfuI GTATCC 1 cut(s) 105
BisI GCNGC 2 cut(s) 171, 207
BlsI GCNGC 2 cut(s) 172, 208
BmgT120I GGNCC 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse1I ACTGG 3 cut(s) 46, 87, 281
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 233
BseNI ACTGG 3 cut(s) 46, 87, 281
BseXI GCAGC 2 cut(s) 157, 218
BseYI CCCAGC 1 cut(s) 98
BsgI GTGCAG 1 cut(s) 156
BshFI GGCC 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 1 cut(s) 251
BsnI GGCC 1 cut(s) 137
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 232
BsrI ACTGG 3 cut(s) 46, 87, 281
BssNAI GTATAC 1 cut(s) 228
Bst1107I GTATAC 1 cut(s) 228
Bst4CI ACNGT 1 cut(s) 177
BstDEI CTNAG 1 cut(s) 219
BstMAI GTCTC 1 cut(s) 251
BstV1I GCAGC 2 cut(s) 157, 218
BstXI CCANNNNNNTGG 1 cut(s) 106
BstZ17I GTATAC 1 cut(s) 228
BsuI GTATCC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 136
Csp6I GTAC 1 cut(s) 278
CviAII CATG 1 cut(s) 7
CviJI RGCY 4 cut(s) 102, 119, 137, 308
CviKI_1 RGCY 4 cut(s) 102, 119, 137, 308
CviQI GTAC 1 cut(s) 278
DdeI CTNAG 1 cut(s) 219
Eco57I CTGAAG 1 cut(s) 294
EcoO109I RGGNCCY 1 cut(s) 136
FaeI CATG 1 cut(s) 10
FaiI YATR 4 cut(s) 8, 57, 75, 228
FatI CATG 1 cut(s) 6
FblI GTMKAC 1 cut(s) 227
Fnu4HI GCNGC 2 cut(s) 171, 207
Fsp4HI GCNGC 2 cut(s) 171, 207
FspBI CTAG 1 cut(s) 24
GluI GCNGC 2 cut(s) 171, 207
GsaI CCCAGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 1 cut(s) 10
HincII GTYRAC 1 cut(s) 180
HindII GTYRAC 1 cut(s) 180
HindIII AAGCTT 1 cut(s) 306
HinfI GANTC 4 cut(s) 42, 59, 83, 122
HphI GGTGA 1 cut(s) 283
Hpy166II GTNNAC 3 cut(s) 180, 228, 321
Hpy188I TCNGA 1 cut(s) 313
Hpy188III TCNNGA 2 cut(s) 196, 221
Hpy8I GTNNAC 3 cut(s) 180, 228, 321
HpyAV CCTTC 2 cut(s) 149, 196
HpyCH4III ACNGT 1 cut(s) 177
HpyCH4V TGCA 5 cut(s) 17, 113, 153, 173, 251
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 1 cut(s) 10
LpnPI CCDG 5 cut(s) 59, 100, 112, 206, 294
Lsp1109I GCAGC 2 cut(s) 157, 218
MaeI CTAG 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 19
MboII GAAGA 2 cut(s) 51, 211
MluCI AATT 3 cut(s) 148, 191, 300
MnlI CCTC 4 cut(s) 61, 127, 153, 238
MseI TTAA 1 cut(s) 147
NlaIII CATG 1 cut(s) 10
PfeI GAWTC 4 cut(s) 42, 59, 83, 122
PflMI CCANNNNNTGG 1 cut(s) 164
PkrI GCNGC 2 cut(s) 172, 208
PspFI CCCAGC 1 cut(s) 98
PspPI GGNCC 1 cut(s) 136
RsaI GTAC 1 cut(s) 279
RsaNI GTAC 1 cut(s) 278
SaqAI TTAA 1 cut(s) 147
SatI GCNGC 2 cut(s) 171, 207
Sau96I GGNCC 1 cut(s) 136
SetI ASST 5 cut(s) 72, 104, 121, 249, 310
SpeI ACTAGT 1 cut(s) 23
Sse9I AATT 3 cut(s) 148, 191, 300
SspI AATATT 1 cut(s) 163
SspMI CTAG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 177
TasI AATT 3 cut(s) 148, 191, 300
TfiI GAWTC 4 cut(s) 42, 59, 83, 122
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TseI GCWGC 2 cut(s) 170, 206
TspDTI ATGAA 4 cut(s) 40, 72, 90, 276
Van91I CCANNNNNTGG 1 cut(s) 164
XapI RAATTY 1 cut(s) 191
XmiI GTMKAC 1 cut(s) 227
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.