Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr6

Orthogroup ID

OG0018233

Physical Location & Seq

Genomic Coordinates Forward (+)

14099546 .. 14100473

Gene Structure 928 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000027698

Sequence Viewer

CDS Protein Promoter (2k)

Length: 495 bp

ATGACGATGGCTGGTAATCCTGGTATTGAGAATGAAGAGTACTTCACACCACCACGTAGCTTCTCATCATCATTGAAAATGCCGAAGAATCTCTCAAGATCTGCTGATAATGAAAAGACTCATAAGCTTCGGAGAAACAAGTACTCCAAAGCAATTTTGAAGCACTTAAACAAGGCTAAAGCCATCAAAAAGCCAATAAACCTCGCAAGACGTCATGAGCTTCCTGGGATTAAATGGTCCAAGTCGGTTTTACAACACGTAAAAGGTTGTGTACTCATCAAAAAGCCAACAACAATTGGTGATTACAAAGAAACTAGTAGCAACAACACCCCTACTCTTTTCAAAGACAAATACTCCGAAGCGATTTTGCAGCACTTAAACAAGGCTTATCTAGCCATCAAGAAGTCAATAACCAAGGCAAGATGTCATGAGCTTCCTGGAATTAAGCGCTCCAAGGAGATTTTACAACACAGTCAACACTTAAAACAAGACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

165

Amino Acids

18.75

Weight (kDa)

10.14

Isoelectric Point (pI)

59.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018233)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000016610 RLG00000016612 RLG00000027698
rosa_multiflora	Rmu_sc0002497.1_g000005
rosa_rugosa	Rorug01G0291700 Rorug01G0291800
rosa_samantha	Rh1BG265400 Rh1BG265500 Rh1DG295400 Rh1DG295500 Rh2DG105200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	214
AcyI	GRCGYC	1 cut(s)	211
AfaI	GTAC	3 cut(s)	41, 143, 273
AfeI	AGCGCT	1 cut(s)	449
AflIII	ACRYGT	1 cut(s)	256
AgsI	TTSAA	3 cut(s)	76, 160, 343
AhlI	ACTAGT	1 cut(s)	314
AjnI	CCWGG	3 cut(s)	19, 223, 436
AluBI	AGCT	4 cut(s)	60, 127, 220, 433
AluI	AGCT	4 cut(s)	60, 127, 220, 433
Aor51HI	AGCGCT	1 cut(s)	449
ApeKI	GCWGC	1 cut(s)	370
AspLEI	GCGC	1 cut(s)	450
AspS9I	GGNCC	1 cut(s)	237
AsuHPI	GGTGA	1 cut(s)	311
AvaII	GGWCC	1 cut(s)	237
BbvI	GCAGC	1 cut(s)	382
BccI	CCATC	2 cut(s)	191, 404
BciT130I	CCWGG	3 cut(s)	21, 225, 438
BcuI	ACTAGT	1 cut(s)	314
BfaI	CTAG	3 cut(s)	315, 392, 493
BfoI	RGCGCY	1 cut(s)	451
BglII	AGATCT	1 cut(s)	98
BisI	GCNGC	1 cut(s)	371
BlsI	GCNGC	1 cut(s)	372
BmcAI	AGTACT	2 cut(s)	41, 143
Bme1390I	CCNGG	3 cut(s)	21, 225, 438
Bme18I	GGWCC	1 cut(s)	237
BmgT120I	GGNCC	1 cut(s)	237
BmrFI	CCNGG	3 cut(s)	21, 225, 438
BpuEI	CTTGAG	1 cut(s)	79
BsaAI	YACGTR	2 cut(s)	56, 259
BsaHI	GRCGYC	1 cut(s)	211
BsaJI	CCNNGG	3 cut(s)	224, 414, 453
BsaXI	ACNNNNNCTCC	4 cut(s)	128, 158, 338, 368
BseBI	CCWGG	3 cut(s)	21, 225, 438
BseDI	CCNNGG	3 cut(s)	224, 414, 453
BseXI	GCAGC	1 cut(s)	382
Bsp143I	GATC	1 cut(s)	98
BspHI	TCATGA	2 cut(s)	214, 427
BssECI	CCNNGG	3 cut(s)	224, 414, 453
BssMI	GATC	1 cut(s)	98
BssNI	GRCGYC	1 cut(s)	211
BssT1I	CCWWGG	2 cut(s)	414, 453
Bst2UI	CCWGG	3 cut(s)	21, 225, 438
Bst4CI	ACNGT	1 cut(s)	473
Bst6I	CTCTTC	1 cut(s)	30
BstACI	GRCGYC	1 cut(s)	211
BstBAI	YACGTR	2 cut(s)	56, 259
BstH2I	RGCGCY	1 cut(s)	451
BstHHI	GCGC	1 cut(s)	450
BstKTI	GATC	1 cut(s)	101
BstMBI	GATC	1 cut(s)	98
BstMWI	GCNNNNNNNGC	1 cut(s)	392
BstNI	CCWGG	3 cut(s)	21, 225, 438
BstSCI	CCNGG	3 cut(s)	19, 223, 436
BstV1I	GCAGC	1 cut(s)	382
BstX2I	RGATCY	1 cut(s)	98
BstYI	RGATCY	1 cut(s)	98
CciI	TCATGA	2 cut(s)	214, 427
CfoI	GCGC	1 cut(s)	450
Cfr13I	GGNCC	1 cut(s)	237
Csp6I	GTAC	3 cut(s)	40, 142, 272
CviAII	CATG	2 cut(s)	215, 428
CviQI	GTAC	3 cut(s)	40, 142, 272
DpnI	GATC	1 cut(s)	100
DpnII	GATC	1 cut(s)	98
Eam1104I	CTCTTC	1 cut(s)	30
EarI	CTCTTC	1 cut(s)	30
Eco130I	CCWWGG	2 cut(s)	414, 453
Eco47I	GGWCC	1 cut(s)	237
Eco47III	AGCGCT	1 cut(s)	449
EcoRII	CCWGG	3 cut(s)	19, 223, 436
EcoT14I	CCWWGG	2 cut(s)	414, 453
ErhI	CCWWGG	2 cut(s)	414, 453
FaeI	CATG	2 cut(s)	218, 431
FaiI	YATR	3 cut(s)	123, 216, 429
FatI	CATG	2 cut(s)	214, 427
Fnu4HI	GCNGC	1 cut(s)	371
Fsp4HI	GCNGC	1 cut(s)	371
FspBI	CTAG	3 cut(s)	315, 392, 493
GlaI	GCGC	1 cut(s)	449
GluI	GCNGC	1 cut(s)	371
HaeII	RGCGCY	1 cut(s)	451
HhaI	GCGC	1 cut(s)	450
Hin1I	GRCGYC	1 cut(s)	211
Hin1II	CATG	2 cut(s)	218, 431
Hin6I	GCGC	1 cut(s)	448
HinP1I	GCGC	1 cut(s)	448
HincII	GTYRAC	1 cut(s)	476
HindII	GTYRAC	1 cut(s)	476
HindIII	AAGCTT	1 cut(s)	125
HinfI	GANTC	2 cut(s)	88, 118
HphI	GGTGA	1 cut(s)	311
Hpy166II	GTNNAC	2 cut(s)	272, 476
Hpy188I	TCNGA	2 cut(s)	132, 358
Hpy188III	TCNNGA	4 cut(s)	96, 215, 400, 428
Hpy8I	GTNNAC	2 cut(s)	272, 476
HpyCH4III	ACNGT	1 cut(s)	473
HpyCH4IV	ACGT	3 cut(s)	55, 211, 258
HpyCH4V	TGCA	1 cut(s)	370
HpyF10VI	GCNNNNNNNGC	1 cut(s)	392
HpySE526I	ACGT	3 cut(s)	55, 211, 258
Hsp92I	GRCGYC	1 cut(s)	211
Hsp92II	CATG	2 cut(s)	218, 431
HspAI	GCGC	1 cut(s)	448
Kzo9I	GATC	1 cut(s)	98
LmnI	GCTCC	1 cut(s)	455
LpnPI	CCDG	6 cut(s)	6, 33, 210, 237, 423, 450
Lsp1109I	GCAGC	1 cut(s)	382
MaeI	CTAG	3 cut(s)	315, 392, 493
MaeII	ACGT	3 cut(s)	55, 211, 258
MalI	GATC	1 cut(s)	100
MboI	GATC	1 cut(s)	98
MboII	GAAGA	2 cut(s)	47, 97
MfeI	CAATTG	1 cut(s)	294
MflI	RGATCY	1 cut(s)	98
MluCI	AATT	3 cut(s)	153, 294, 441
MlyI	GAGTC	1 cut(s)	112
MnlI	CCTC	1 cut(s)	212
MseI	TTAA	5 cut(s)	167, 231, 377, 444, 482
MspR9I	CCNGG	3 cut(s)	21, 225, 438
MunI	CAATTG	1 cut(s)	294
MvaI	CCWGG	3 cut(s)	21, 225, 438
MwoI	GCNNNNNNNGC	1 cut(s)	392
NdeII	GATC	1 cut(s)	98
NlaIII	CATG	2 cut(s)	218, 431
PagI	TCATGA	2 cut(s)	214, 427
PfeI	GAWTC	1 cut(s)	88
PfoI	TCCNGGA	1 cut(s)	436
PkrI	GCNGC	1 cut(s)	372
PleI	GAGTC	1 cut(s)	112
PpsI	GAGTC	1 cut(s)	112
Ppu21I	YACGTR	2 cut(s)	56, 259
Psp6I	CCWGG	3 cut(s)	19, 223, 436
PspGI	CCWGG	3 cut(s)	19, 223, 436
PspPI	GGNCC	1 cut(s)	237
PsuI	RGATCY	1 cut(s)	98
RsaI	GTAC	3 cut(s)	41, 143, 273
RsaNI	GTAC	3 cut(s)	40, 142, 272
SaqAI	TTAA	5 cut(s)	167, 231, 377, 444, 482
SatI	GCNGC	1 cut(s)	371
Sau3AI	GATC	1 cut(s)	98
Sau96I	GGNCC	1 cut(s)	237
ScaI	AGTACT	2 cut(s)	41, 143
SchI	GAGTC	1 cut(s)	112
ScrFI	CCNGG	3 cut(s)	21, 225, 438
SetI	ASST	9 cut(s)	58, 62, 129, 204, 214, 222, 261, 268, 435
SinI	GGWCC	1 cut(s)	237
SmlI	CTYRAG	1 cut(s)	94
SmoI	CTYRAG	1 cut(s)	94
SpeI	ACTAGT	1 cut(s)	314
Sse9I	AATT	3 cut(s)	153, 294, 441
SspMI	CTAG	3 cut(s)	315, 392, 493
StyD4I	CCNGG	3 cut(s)	19, 223, 436
StyI	CCWWGG	2 cut(s)	414, 453
TaaI	ACNGT	1 cut(s)	473
TaiI	ACGT	3 cut(s)	58, 214, 261
TasI	AATT	3 cut(s)	153, 294, 441
TatI	WGTACW	3 cut(s)	39, 141, 271
TfiI	GAWTC	1 cut(s)	88
Tru1I	TTAA	5 cut(s)	167, 231, 377, 444, 482
Tru9I	TTAA	5 cut(s)	167, 231, 377, 444, 482
TseI	GCWGC	1 cut(s)	370
TspDTI	ATGAA	2 cut(s)	48, 126
VpaK11BI	GGWCC	1 cut(s)	237
XspI	CTAG	3 cut(s)	315, 392, 493
ZraI	GACGTC	1 cut(s)	212
ZrmI	AGTACT	2 cut(s)	41, 143

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.