Rmu_co7958197.1_g000001

Belongs to the STXBP unc-18 SEC1 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7958197.1
Physical Location & Seq
Reverse (-)
2 .. 466
465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7958197.1_g000001.1.cds

Sequence Viewer

Length: 465 bp
atggagatattttcacttggtgatctctcaaaaactgtggggaagatgttgacagacatgtcaagtctttatgatgttggtcgccgtaaacgatcagcagggctattactcattgaccgtacactagatcttcttactccatgctgtcatggagattcacttgttgaccgtgtgttttcatccttgcctagtagggaaaatacagcatcctatactcaaataaaaacatcaaaaagccaactaaaacagggcccttcaaacctggaacgtgcttctcttgatgttcagataccacttgctaaaattctaattgaagaagattgcaagatagagagctttcggctattagaaagcattgaagcttttctatgtgggtgggattctggaaactctgcttctcaagttttagatctgagcaatctcaagaacaaaattcataatgagaagcttccccagtcagagaat
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

155

Amino Acids

17.22

Weight (kDa)

5.71

Isoelectric Point (pI)

57.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011362)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 58
AcsI RAATTY 2 cut(s) 303, 432
AdeI CACNNNGTG 1 cut(s) 20
AfaI GTAC 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 57
AgsI TTSAA 3 cut(s) 258, 314, 359
AjnI CCWGG 1 cut(s) 261
AluBI AGCT 3 cut(s) 336, 362, 448
AluI AGCT 3 cut(s) 336, 362, 448
AoxI GGCC 1 cut(s) 250
ApaI GGGCCC 1 cut(s) 254
ApoI RAATTY 2 cut(s) 303, 432
Asp700I GAANNNNTTC 1 cut(s) 363
AspS9I GGNCC 2 cut(s) 250, 251
AsuHPI GGTGA 1 cut(s) 32
BaeGI GKGCMC 1 cut(s) 254
BanII GRGCYC 1 cut(s) 254
BceAI ACGGC 1 cut(s) 69
BciT130I CCWGG 1 cut(s) 263
BfaI CTAG 2 cut(s) 125, 189
BglII AGATCT 2 cut(s) 127, 409
Bme1390I CCNGG 1 cut(s) 263
BmgT120I GGNCC 2 cut(s) 250, 251
BmiI GGNNCC 1 cut(s) 252
BmrFI CCNGG 1 cut(s) 263
BmrI ACTGGG 1 cut(s) 448
BmsI GCATC 1 cut(s) 215
BmuI ACTGGG 1 cut(s) 448
BpuEI CTTGAG 2 cut(s) 384, 407
Bse1I ACTGG 1 cut(s) 454
BseBI CCWGG 1 cut(s) 263
BseGI GGATG 2 cut(s) 179, 206
BseMII CTCAG 1 cut(s) 404
BseNI ACTGG 1 cut(s) 454
BseSI GKGCMC 1 cut(s) 254
BshFI GGCC 1 cut(s) 252
BsnI GGCC 1 cut(s) 252
Bsp120I GGGCCC 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 254
Bsp143I GATC 4 cut(s) 22, 92, 127, 409
BspANI GGCC 1 cut(s) 252
BspCNI CTCAG 1 cut(s) 405
BspLI GGNNCC 1 cut(s) 252
BsrI ACTGG 1 cut(s) 454
BssMI GATC 4 cut(s) 22, 92, 127, 409
Bst2UI CCWGG 1 cut(s) 263
Bst4CI ACNGT 3 cut(s) 37, 119, 170
BstDEI CTNAG 1 cut(s) 413
BstF5I GGATG 2 cut(s) 179, 206
BstKTI GATC 4 cut(s) 25, 95, 130, 412
BstMBI GATC 4 cut(s) 22, 92, 127, 409
BstNI CCWGG 1 cut(s) 263
BstNSI RCATGY 1 cut(s) 61
BstSCI CCNGG 1 cut(s) 261
BstSLI GKGCMC 1 cut(s) 254
BstX2I RGATCY 2 cut(s) 127, 409
BstYI RGATCY 2 cut(s) 127, 409
BsuRI GGCC 1 cut(s) 252
BtsCI GGATG 2 cut(s) 179, 206
Cfr13I GGNCC 2 cut(s) 250, 251
Csp6I GTAC 1 cut(s) 120
CspCI CAANNNNNGTGG 2 cut(s) 18, 53
CviAII CATG 3 cut(s) 58, 141, 149
CviJI RGCY 7 cut(s) 103, 237, 252, 336, 343, 362, 448
CviKI_1 RGCY 7 cut(s) 103, 237, 252, 336, 343, 362, 448
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 413
DpnI GATC 4 cut(s) 24, 94, 129, 411
DpnII GATC 4 cut(s) 22, 92, 127, 409
DraIII CACNNNGTG 1 cut(s) 20
DrdI GACNNNNNNGTC 1 cut(s) 58
DseDI GACNNNNNNGTC 1 cut(s) 58
Eco24I GRGCYC 1 cut(s) 254
EcoO109I RGGNCCY 2 cut(s) 250, 251
EcoRII CCWGG 1 cut(s) 261
EcoT38I GRGCYC 1 cut(s) 254
FaeI CATG 3 cut(s) 61, 144, 152
FaiI YATR 7 cut(s) 59, 72, 142, 150, 213, 370, 438
FatI CATG 3 cut(s) 57, 140, 148
FokI GGATG 2 cut(s) 166, 193
FriOI GRGCYC 1 cut(s) 254
FspBI CTAG 2 cut(s) 125, 189
HaeIII GGCC 1 cut(s) 252
Hin1II CATG 3 cut(s) 61, 144, 152
HincII GTYRAC 2 cut(s) 51, 166
HindII GTYRAC 2 cut(s) 51, 166
HindIII AAGCTT 2 cut(s) 360, 446
HinfI GANTC 2 cut(s) 155, 380
HphI GGTGA 1 cut(s) 32
Hpy166II GTNNAC 4 cut(s) 51, 89, 122, 166
Hpy188I TCNGA 3 cut(s) 288, 414, 460
Hpy188III TCNNGA 3 cut(s) 278, 384, 424
Hpy8I GTNNAC 4 cut(s) 51, 89, 122, 166
HpyAV CCTTC 1 cut(s) 264
HpyCH4III ACNGT 3 cut(s) 37, 119, 170
HpyCH4IV ACGT 1 cut(s) 268
HpyCH4V TGCA 1 cut(s) 324
HpyF3I CTNAG 1 cut(s) 413
HpySE526I ACGT 1 cut(s) 268
Hsp92II CATG 3 cut(s) 61, 144, 152
Kzo9I GATC 4 cut(s) 22, 92, 127, 409
LpnPI CCDG 5 cut(s) 84, 233, 248, 275, 369
LweI GCATC 1 cut(s) 215
MaeI CTAG 2 cut(s) 125, 189
MaeII ACGT 1 cut(s) 268
MalI GATC 4 cut(s) 24, 94, 129, 411
MboI GATC 4 cut(s) 22, 92, 127, 409
MboII GAAGA 4 cut(s) 55, 122, 326, 329
MflI RGATCY 2 cut(s) 127, 409
MhlI GDGCHC 1 cut(s) 254
MluCI AATT 3 cut(s) 303, 309, 432
MroXI GAANNNNTTC 1 cut(s) 363
MspR9I CCNGG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 263
NdeII GATC 4 cut(s) 22, 92, 127, 409
NlaIII CATG 3 cut(s) 61, 144, 152
NlaIV GGNNCC 1 cut(s) 252
NspI RCATGY 1 cut(s) 61
PciI ACATGT 1 cut(s) 57
PcsI WCGNNNNNNNCGW 1 cut(s) 88
PdmI GAANNNNTTC 1 cut(s) 363
PfeI GAWTC 2 cut(s) 155, 380
PscI ACATGT 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PspN4I GGNNCC 1 cut(s) 252
PspOMI GGGCCC 1 cut(s) 250
PspPI GGNCC 2 cut(s) 250, 251
PsuI RGATCY 2 cut(s) 127, 409
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
Sau3AI GATC 4 cut(s) 22, 92, 127, 409
Sau96I GGNCC 2 cut(s) 250, 251
ScrFI CCNGG 1 cut(s) 263
SduI GDGCHC 1 cut(s) 254
SetI ASST 5 cut(s) 264, 271, 338, 364, 450
SfaNI GCATC 1 cut(s) 215
SmlI CTYRAG 2 cut(s) 399, 422
SmoI CTYRAG 2 cut(s) 399, 422
Sse9I AATT 3 cut(s) 303, 309, 432
SspMI CTAG 2 cut(s) 125, 189
StyD4I CCNGG 1 cut(s) 261
TaaI ACNGT 3 cut(s) 37, 119, 170
TaiI ACGT 1 cut(s) 271
TasI AATT 3 cut(s) 303, 309, 432
TfiI GAWTC 2 cut(s) 155, 380
TspDTI ATGAA 2 cut(s) 168, 425
XapI RAATTY 2 cut(s) 303, 432
XceI RCATGY 1 cut(s) 61
XmnI GAANNNNTTC 1 cut(s) 363
XspI CTAG 2 cut(s) 125, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.