Rmu_co7977474.1_g000001

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7977474.1
Physical Location & Seq
Reverse (-)
2 .. 475
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7977474.1_g000001.1.cds

Sequence Viewer

Length: 474 bp
ctgttctatcttcatgaagaatgggaacaggttgtgattcatagggatgtgaaggccagtaatgtgttggtagatggggaattgaatggaaagctaggagatttcgggcttgcaagattatacgaccatggaacagaccctcaaacaactcatatagttggaacactagggtacctagccccagagcacacaagaacaggttgggccaccacgagcaccgacgtgtttgcttttggggcatttttgctcgaagttgcttgcggaaaaaggcctattgagagacaaggtccagaagctgagattttgcttgattgggtattttcttgttggaatagaagtaacatccttgaggcaagagatcaaaggtttggtacggattttgtagccgaggaattggagttggtgttgaagcttgggcttttgtgctctcattcggagccagcggcaaggccaagcatgcgacaagtcgttcag

Protein Analysis

158

Amino Acids

17.75

Weight (kDa)

5.05

Isoelectric Point (pI)

42.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019282)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 171
AccB1I GGYRCC 1 cut(s) 171
AciI CCGC 2 cut(s) 261, 443
AfaI GTAC 2 cut(s) 173, 373
AflIII ACRYGT 1 cut(s) 222
AgsI TTSAA 2 cut(s) 85, 409
AjiI CACGTC 1 cut(s) 223
AleI CACNNNNGTG 1 cut(s) 221
AluBI AGCT 3 cut(s) 94, 296, 412
AluI AGCT 3 cut(s) 94, 296, 412
Alw21I GWGCWC 3 cut(s) 189, 218, 428
Alw26I GTCTC 1 cut(s) 274
AlwNI CAGNNNCTG 1 cut(s) 296
AoxI GGCC 4 cut(s) 54, 204, 269, 449
Asp718I GGTACC 1 cut(s) 171
AspS9I GGNCC 2 cut(s) 204, 287
AvaII GGWCC 1 cut(s) 287
BaeI ACNNNNGTAYC 2 cut(s) 155, 188
BanI GGYRCC 1 cut(s) 171
BauI CACGAG 1 cut(s) 211
Bbv12I GWGCWC 3 cut(s) 189, 218, 428
BccI CCATC 1 cut(s) 68
BcgI CGANNNNNNTGC 2 cut(s) 209, 243
BcoDI GTCTC 1 cut(s) 274
BfaI CTAG 3 cut(s) 95, 167, 176
BisI GCNGC 1 cut(s) 444
BlsI GCNGC 1 cut(s) 445
Bme18I GGWCC 1 cut(s) 287
BmgBI CACGTC 1 cut(s) 223
BmgT120I GGNCC 2 cut(s) 204, 287
BmiI GGNNCC 2 cut(s) 173, 438
BpuEI CTTGAG 1 cut(s) 368
BsaJI CCNNGG 2 cut(s) 127, 387
BsaXI ACNNNNNCTCC 2 cut(s) 389, 419
Bse1I ACTGG 1 cut(s) 57
BseDI CCNNGG 2 cut(s) 127, 387
BseGI GGATG 2 cut(s) 52, 342
BseMII CTCAG 1 cut(s) 288
BseNI ACTGG 1 cut(s) 57
BshFI GGCC 4 cut(s) 56, 206, 271, 451
BshNI GGYRCC 1 cut(s) 171
BsiHKAI GWGCWC 3 cut(s) 189, 218, 428
BsmAI GTCTC 1 cut(s) 274
BsnI GGCC 4 cut(s) 56, 206, 271, 451
Bsp1286I GDGCHC 3 cut(s) 189, 218, 428
Bsp143I GATC 1 cut(s) 358
Bsp19I CCATGG 1 cut(s) 127
BspACI CCGC 2 cut(s) 261, 443
BspANI GGCC 4 cut(s) 56, 206, 271, 451
BspCNI CTCAG 1 cut(s) 289
BspHI TCATGA 1 cut(s) 13
BspLI GGNNCC 2 cut(s) 173, 438
BspT107I GGYRCC 1 cut(s) 171
BsrI ACTGG 1 cut(s) 57
BssECI CCNNGG 2 cut(s) 127, 387
BssMI GATC 1 cut(s) 358
BssSI CACGAG 1 cut(s) 211
BssT1I CCWWGG 1 cut(s) 127
Bst2BI CACGAG 1 cut(s) 211
BstC8I GCNNGC 4 cut(s) 111, 259, 441, 458
BstDEI CTNAG 1 cut(s) 297
BstDSI CCRYGG 1 cut(s) 127
BstF5I GGATG 2 cut(s) 52, 342
BstKTI GATC 1 cut(s) 361
BstMAI GTCTC 1 cut(s) 274
BstMBI GATC 1 cut(s) 358
BstMWI GCNNNNNNNGC 2 cut(s) 236, 457
BstNSI RCATGY 1 cut(s) 460
BsuRI GGCC 4 cut(s) 56, 206, 271, 451
BtgI CCRYGG 1 cut(s) 127
BtrI CACGTC 1 cut(s) 223
BtsCI GGATG 2 cut(s) 52, 342
Cac8I GCNNGC 4 cut(s) 111, 259, 441, 458
CaiI CAGNNNCTG 1 cut(s) 296
CciI TCATGA 1 cut(s) 13
Cfr13I GGNCC 2 cut(s) 204, 287
Csp6I GTAC 2 cut(s) 172, 372
CviAII CATG 3 cut(s) 14, 128, 457
CviQI GTAC 2 cut(s) 172, 372
DdeI CTNAG 1 cut(s) 297
DpnI GATC 1 cut(s) 360
DpnII GATC 1 cut(s) 358
Eco130I CCWWGG 1 cut(s) 127
Eco147I AGGCCT 1 cut(s) 271
Eco47I GGWCC 1 cut(s) 287
EcoT14I CCWWGG 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 127
FaeI CATG 3 cut(s) 17, 131, 460
FaiI YATR 7 cut(s) 15, 42, 121, 129, 153, 155, 458
FatI CATG 3 cut(s) 13, 127, 456
Fnu4HI GCNGC 1 cut(s) 444
FokI GGATG 2 cut(s) 59, 329
Fsp4HI GCNGC 1 cut(s) 444
FspBI CTAG 3 cut(s) 95, 167, 176
GluI GCNGC 1 cut(s) 444
HaeIII GGCC 4 cut(s) 56, 206, 271, 451
Hin1II CATG 3 cut(s) 17, 131, 460
HindIII AAGCTT 1 cut(s) 410
HinfI GANTC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 436
Hpy188III TCNNGA 2 cut(s) 14, 290
Hpy99I CGWCG 1 cut(s) 224
HpyAV CCTTC 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 222
HpyCH4V TGCA 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 457
HpyF3I CTNAG 1 cut(s) 297
HpySE526I ACGT 1 cut(s) 222
Hsp92II CATG 3 cut(s) 17, 131, 460
KpnI GGTACC 1 cut(s) 175
Kzo9I GATC 1 cut(s) 358
LmnI GCTCC 1 cut(s) 436
LpnPI CCDG 6 cut(s) 14, 70, 183, 195, 303, 453
MaeI CTAG 3 cut(s) 95, 167, 176
MaeII ACGT 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 338
MalI GATC 1 cut(s) 360
MboI GATC 1 cut(s) 358
MboII GAAGA 1 cut(s) 29
MhlI GDGCHC 3 cut(s) 189, 218, 428
MluCI AATT 2 cut(s) 80, 392
MmeI TCCRAC 2 cut(s) 139, 308
MnlI CCTC 3 cut(s) 150, 343, 382
MslI CAYNNNNRTG 2 cut(s) 45, 221
MspA1I CMGCKG 1 cut(s) 443
MwoI GCNNNNNNNGC 2 cut(s) 236, 457
NcoI CCATGG 1 cut(s) 127
NdeII GATC 1 cut(s) 358
NlaIII CATG 3 cut(s) 17, 131, 460
NlaIV GGNNCC 2 cut(s) 173, 438
NmeAIII GCCGAG 1 cut(s) 412
NspI RCATGY 1 cut(s) 460
OliI CACNNNNGTG 1 cut(s) 221
PaeI GCATGC 1 cut(s) 460
PagI TCATGA 1 cut(s) 13
PceI AGGCCT 1 cut(s) 271
PfeI GAWTC 1 cut(s) 37
PflFI GACNNNGTC 1 cut(s) 285
PkrI GCNGC 1 cut(s) 445
PspN4I GGNNCC 2 cut(s) 173, 438
PspPI GGNCC 2 cut(s) 204, 287
PstNI CAGNNNCTG 1 cut(s) 296
PsyI GACNNNGTC 1 cut(s) 285
RsaI GTAC 2 cut(s) 173, 373
RsaNI GTAC 2 cut(s) 172, 372
RseI CAYNNNNRTG 2 cut(s) 45, 221
SatI GCNGC 1 cut(s) 444
Sau3AI GATC 1 cut(s) 358
Sau96I GGNCC 2 cut(s) 204, 287
SduI GDGCHC 3 cut(s) 189, 218, 428
SetI ASST 9 cut(s) 33, 96, 177, 202, 225, 289, 298, 368, 414
SinI GGWCC 1 cut(s) 287
SmiMI CAYNNNNRTG 2 cut(s) 45, 221
SmlI CTYRAG 1 cut(s) 347
SmoI CTYRAG 1 cut(s) 347
SphI GCATGC 1 cut(s) 460
Sse9I AATT 2 cut(s) 80, 392
SseBI AGGCCT 1 cut(s) 271
SsiI CCGC 2 cut(s) 261, 443
SspMI CTAG 3 cut(s) 95, 167, 176
StuI AGGCCT 1 cut(s) 271
StyI CCWWGG 1 cut(s) 127
TaiI ACGT 1 cut(s) 225
TaqI TCGA 1 cut(s) 249
TasI AATT 2 cut(s) 80, 392
TauI GCSGC 1 cut(s) 446
TfiI GAWTC 1 cut(s) 37
TspDTI ATGAA 2 cut(s) 29, 30
TspGWI ACGGA 1 cut(s) 389
Tth111I GACNNNGTC 1 cut(s) 285
VpaK11BI GGWCC 1 cut(s) 287
XceI RCATGY 1 cut(s) 460
XcmI CCANNNNNNNNNTGG 1 cut(s) 64
XspI CTAG 3 cut(s) 95, 167, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.