Rmu_co8005646.1_g000001

J domain-containing protein required for chloroplast accumulation response

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8005646.1
Physical Location & Seq
Forward (+)
1 .. 529
529 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8005646.1_g000001.1.cds

Sequence Viewer

Length: 223 bp
aaatactggagatttagatgagtccttccatgaaaacttccagatcaaagaattaactcaagatgagaagaaaccgccagtagttggcaataatcatgaggagttgcaggttattgatgctaaaatccggcagtggtcaaagggaaaggaaggaaacatacgctcactgctcactactatgcaacatgtgagcatttttgtcattccgtctttgaagacgacc

Protein Analysis

74

Amino Acids

8.46

Weight (kDa)

5.86

Isoelectric Point (pI)

28.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 98
AccB7I CCANNNNNTGG 1 cut(s) 84
AciI CCGC 1 cut(s) 75
AfiI CCNNNNNNNGG 1 cut(s) 84
AflIII ACRYGT 1 cut(s) 185
AgsI TTSAA 1 cut(s) 215
BarI GAAGNNNNNNTAC 2 cut(s) 142, 174
BfuAI ACCTGC 1 cut(s) 98
BmsI GCATC 1 cut(s) 107
BpmI CTGGAG 1 cut(s) 28
BpuEI CTTGAG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 84
Bse1I ACTGG 2 cut(s) 11, 78
BseLI CCNNNNNNNGG 1 cut(s) 84
BseNI ACTGG 2 cut(s) 11, 78
BseRI GAGGAG 1 cut(s) 114
BsiSI CCGG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 43
BspACI CCGC 1 cut(s) 75
BspHI TCATGA 1 cut(s) 95
BspMI ACCTGC 1 cut(s) 98
BsrI ACTGG 2 cut(s) 11, 78
BssMI GATC 1 cut(s) 43
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstNSI RCATGY 1 cut(s) 189
BtsI GCAGTG 2 cut(s) 138, 165
BtsIMutI CAGTG 2 cut(s) 138, 165
BveI ACCTGC 1 cut(s) 98
CciI TCATGA 1 cut(s) 95
CviAII CATG 3 cut(s) 30, 96, 186
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
FaeI CATG 3 cut(s) 33, 99, 189
FaiI YATR 5 cut(s) 31, 97, 159, 180, 187
FatI CATG 3 cut(s) 29, 95, 185
GsuI CTGGAG 1 cut(s) 28
HapII CCGG 1 cut(s) 128
Hin1II CATG 3 cut(s) 33, 99, 189
HinfI GANTC 1 cut(s) 21
HpaII CCGG 1 cut(s) 128
Hpy188III TCNNGA 3 cut(s) 41, 60, 96
HpyAV CCTTC 2 cut(s) 35, 144
HpyCH4V TGCA 2 cut(s) 107, 182
Hsp92II CATG 3 cut(s) 33, 99, 189
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 4 cut(s) 54, 91, 93, 141
LweI GCATC 1 cut(s) 107
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 80
MluCI AATT 1 cut(s) 51
MlyI GAGTC 1 cut(s) 30
MnlI CCTC 1 cut(s) 92
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 1 cut(s) 177
MspI CCGG 1 cut(s) 128
NdeII GATC 1 cut(s) 43
NlaIII CATG 3 cut(s) 33, 99, 189
NspI RCATGY 1 cut(s) 189
PagI TCATGA 1 cut(s) 95
PciI ACATGT 1 cut(s) 185
PflMI CCANNNNNTGG 1 cut(s) 84
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
PscI ACATGT 1 cut(s) 185
RseI CAYNNNNRTG 1 cut(s) 177
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 43
SchI GAGTC 1 cut(s) 30
SetI ASST 1 cut(s) 112
SfaNI GCATC 1 cut(s) 107
SgeI CNNG 9 cut(s) 19, 42, 53, 72, 90, 108, 120, 140, 198
SmiMI CAYNNNNRTG 1 cut(s) 177
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 1 cut(s) 51
SsiI CCGC 1 cut(s) 75
TasI AATT 1 cut(s) 51
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 2 cut(s) 138, 172
TspDTI ATGAA 1 cut(s) 46
TspGWI ACGGA 1 cut(s) 196
TspRI CASTG 2 cut(s) 138, 172
Van91I CCANNNNNTGG 1 cut(s) 84
XceI RCATGY 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.