Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8032912.1

Orthogroup ID

OG0003890

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 513

Gene Structure 513 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8032912.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 172 bp

atgctaaggtctcgtgatgagaaaattaaaagacttgagttgttggtggatggaatgttgtctgccgagaagtatctcatggaagagaacaaagctttgctagaagagatgcagatgcttcaaacaagacctgatggaaatccagaattgacccgatatgctgtggagaaca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005856 GO:0005871 GO:0005875 GO:0006928 GO:0007017 GO:0007018 GO:0008150 GO:0009987 GO:0015630 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0032991 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044422 GO:0044424 GO:0044430 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kinesin

Protein Analysis

57

Amino Acids

6.74

Weight (kDa)

4.85

Isoelectric Point (pI)

50.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003890)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G17360 AT3G17360 AT3G17360
fragaria_vesca	FvH4_4g21170 FvH4_4g21170 FvH4_4g21170
malus_domestica	MD16G1139300.v1.1
prunus_persica	Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1 Prupe.1G108800_v2.0.a1
pyrus_communis	pycom16g12370
rosa_chinensis	RchiOBHm_Chr4g0426741
rosa_laevigata	RLG00000007281 RLG00000007283
rosa_multiflora	Rmu_co8032912.1_g000001 Rmu_sc0021664.1_g000001 Rmu_sc0021665.1_g000001 Rmu_sc0033496.1_g000001
rosa_roxburghii	Rroxscaffold_5G00368740
rosa_rugosa	Rorug04G0214500 Rorug04G0214500 Rorug04G0214500
rosa_samantha	Rh4AG269600 Rh4BG275900 Rh4CG290500 Rh4DG272900
rosa_wichuraiana	Rw4G023390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	122
AluBI	AGCT	1 cut(s)	95
AluI	AGCT	1 cut(s)	95
Alw26I	GTCTC	1 cut(s)	15
BauI	CACGAG	1 cut(s)	12
BccI	CCATC	2 cut(s)	44, 128
BcoDI	GTCTC	1 cut(s)	15
BfaI	CTAG	1 cut(s)	101
BmsI	GCATC	2 cut(s)	99, 105
Bpu10I	CCTNAGC	1 cut(s)	5
BpuEI	CTTGAG	1 cut(s)	56
BsaBI	GATNNNNATC	1 cut(s)	138
BsaI	GGTCTC	1 cut(s)	15
Bse8I	GATNNNNATC	1 cut(s)	138
BseGI	GGATG	1 cut(s)	55
BseJI	GATNNNNATC	1 cut(s)	138
BsmAI	GTCTC	1 cut(s)	15
Bso31I	GGTCTC	1 cut(s)	15
BspTNI	GGTCTC	1 cut(s)	15
BssSI	CACGAG	1 cut(s)	12
Bst2BI	CACGAG	1 cut(s)	12
Bst6I	CTCTTC	2 cut(s)	78, 99
BstDEI	CTNAG	1 cut(s)	5
BstF5I	GGATG	1 cut(s)	55
BstMAI	GTCTC	1 cut(s)	15
BtsCI	GGATG	1 cut(s)	55
CviAII	CATG	1 cut(s)	79
CviJI	RGCY	1 cut(s)	95
CviKI_1	RGCY	1 cut(s)	95
DdeI	CTNAG	1 cut(s)	5
Eam1104I	CTCTTC	2 cut(s)	78, 99
EarI	CTCTTC	2 cut(s)	78, 99
Eco31I	GGTCTC	1 cut(s)	15
FaeI	CATG	1 cut(s)	82
FaiI	YATR	2 cut(s)	80, 159
FatI	CATG	1 cut(s)	78
FokI	GGATG	1 cut(s)	62
FspBI	CTAG	1 cut(s)	101
Hin1II	CATG	1 cut(s)	82
HindIII	AAGCTT	1 cut(s)	93
Hpy188III	TCNNGA	2 cut(s)	14, 143
HpyCH4V	TGCA	1 cut(s)	112
HpyF3I	CTNAG	1 cut(s)	5
Hsp92II	CATG	1 cut(s)	82
LpnPI	CCDG	2 cut(s)	144, 156
LweI	GCATC	2 cut(s)	99, 105
MaeI	CTAG	1 cut(s)	101
MboII	GAAGA	2 cut(s)	95, 116
MluCI	AATT	2 cut(s)	24, 146
MseI	TTAA	1 cut(s)	27
NlaIII	CATG	1 cut(s)	82
NmeAIII	GCCGAG	1 cut(s)	91
SaqAI	TTAA	1 cut(s)	27
SetI	ASST	3 cut(s)	11, 97, 133
SfaNI	GCATC	2 cut(s)	99, 105
SmlI	CTYRAG	1 cut(s)	35
SmoI	CTYRAG	1 cut(s)	35
Sse9I	AATT	2 cut(s)	24, 146
SspMI	CTAG	1 cut(s)	101
TasI	AATT	2 cut(s)	24, 146
Tru1I	TTAA	1 cut(s)	27
Tru9I	TTAA	1 cut(s)	27
XspI	CTAG	1 cut(s)	101

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.