Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8075528.1

Orthogroup ID

OG0018797

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 559

Gene Structure 559 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8075528.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

atgttccaagttccaatcccatctccaaagaaaaatgaggttttgctcaagttggaagcagcaagtctaaatccaggtgattgtaagattcagaaaggcatggcgtggcctcttttccctcgcaagttgccacacattcctgtaactgatgtggctggagaggctgtagaggtgggactgggagtcacaaagttcaaagtgggtgacaaagttgtggcaatgctcagctatggt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0009507 GO:0009526 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0009941 GO:0016020 GO:0031967 GO:0031975 GO:0031976 GO:0031984 GO:0034357 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ADH_N ADH_zinc_N_2

Protein Analysis

78

Amino Acids

8.4

Weight (kDa)

9.21

Isoelectric Point (pI)

14.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018797)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g18260 FvH4_2g18300
malus_domestica	MD05G1167100.v1.1
pyrus_communis	pycom10g13560
rosa_multiflora	Rmu_co8075528.1_g000001 Rmu_sc0001521.1_g000008 Rmu_sc0001521.1_g000010 Rmu_sc0002906.1_g000001 Rmu_sc0023365.1_g000004

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	196
AhdI	GACNNNNNGTC	1 cut(s)	182
AjnI	CCWGG	1 cut(s)	73
AluBI	AGCT	1 cut(s)	228
AluI	AGCT	1 cut(s)	228
AoxI	GGCC	1 cut(s)	107
ApeKI	GCWGC	1 cut(s)	59
AsuHPI	GGTGA	2 cut(s)	89, 215
BbvI	GCAGC	1 cut(s)	71
BccI	CCATC	1 cut(s)	28
BciT130I	CCWGG	1 cut(s)	75
BfmI	CTRYAG	1 cut(s)	165
BisI	GCNGC	1 cut(s)	60
BlpI	GCTNAGC	1 cut(s)	224
BlsI	GCNGC	1 cut(s)	61
Bme1390I	CCNGG	1 cut(s)	75
BmeRI	GACNNNNNGTC	1 cut(s)	182
BmrFI	CCNGG	1 cut(s)	75
BmrI	ACTGGG	1 cut(s)	188
BmuI	ACTGGG	1 cut(s)	188
BpmI	CTGGAG	1 cut(s)	177
Bpu1102I	GCTNAGC	1 cut(s)	224
BpuEI	CTTGAG	1 cut(s)	32
BsaXI	ACNNNNNCTCC	2 cut(s)	150, 180
Bse1I	ACTGG	1 cut(s)	183
Bse3DI	GCAATG	1 cut(s)	225
BseBI	CCWGG	1 cut(s)	75
BseMI	GCAATG	1 cut(s)	225
BseNI	ACTGG	1 cut(s)	183
BseXI	GCAGC	1 cut(s)	71
BshFI	GGCC	1 cut(s)	109
BslFI	GGGAC	1 cut(s)	189
BsmFI	GGGAC	1 cut(s)	189
BsnI	GGCC	1 cut(s)	109
Bsp1720I	GCTNAGC	1 cut(s)	224
BspANI	GGCC	1 cut(s)	109
BsrDI	GCAATG	1 cut(s)	225
BsrI	ACTGG	1 cut(s)	183
Bst2UI	CCWGG	1 cut(s)	75
BstDEI	CTNAG	1 cut(s)	224
BstMWI	GCNNNNNNNGC	1 cut(s)	161
BstNI	CCWGG	1 cut(s)	75
BstSCI	CCNGG	1 cut(s)	73
BstSFI	CTRYAG	1 cut(s)	165
BstV1I	GCAGC	1 cut(s)	71
BsuRI	GGCC	1 cut(s)	109
CviAII	CATG	1 cut(s)	100
CviJI	RGCY	4 cut(s)	109, 155, 164, 228
CviKI_1	RGCY	4 cut(s)	109, 155, 164, 228
DdeI	CTNAG	1 cut(s)	224
DriI	GACNNNNNGTC	1 cut(s)	182
Eam1105I	GACNNNNNGTC	1 cut(s)	182
EcoRII	CCWGG	1 cut(s)	73
FaeI	CATG	1 cut(s)	103
FaiI	YATR	2 cut(s)	101, 231
FaqI	GGGAC	1 cut(s)	189
FatI	CATG	1 cut(s)	99
Fnu4HI	GCNGC	1 cut(s)	60
Fsp4HI	GCNGC	1 cut(s)	60
GluI	GCNGC	1 cut(s)	60
GsuI	CTGGAG	1 cut(s)	177
HaeIII	GGCC	1 cut(s)	109
Hin1II	CATG	1 cut(s)	103
HinfI	GANTC	2 cut(s)	88, 183
HphI	GGTGA	2 cut(s)	89, 215
Hpy188I	TCNGA	1 cut(s)	93
HpyF10VI	GCNNNNNNNGC	1 cut(s)	161
HpyF3I	CTNAG	1 cut(s)	224
Hsp92II	CATG	1 cut(s)	103
LpnPI	CCDG	5 cut(s)	60, 87, 141, 153, 164
Lsp1109I	GCAGC	1 cut(s)	71
MaeIII	GTNAC	3 cut(s)	142, 184, 203
MlyI	GAGTC	1 cut(s)	192
MmeI	TCCRAC	1 cut(s)	33
MnlI	CCTC	5 cut(s)	31, 120, 129, 154, 163
MspR9I	CCNGG	1 cut(s)	75
MvaI	CCWGG	1 cut(s)	75
MwoI	GCNNNNNNNGC	1 cut(s)	161
NlaIII	CATG	1 cut(s)	103
NmuCI	GTSAC	2 cut(s)	184, 203
PfeI	GAWTC	1 cut(s)	88
PkrI	GCNGC	1 cut(s)	61
PleI	GAGTC	1 cut(s)	191
PpsI	GAGTC	1 cut(s)	191
Psp6I	CCWGG	1 cut(s)	73
PspGI	CCWGG	1 cut(s)	73
SatI	GCNGC	1 cut(s)	60
SchI	GAGTC	1 cut(s)	192
ScrFI	CCNGG	1 cut(s)	75
SetI	ASST	4 cut(s)	42, 79, 174, 230
SfcI	CTRYAG	1 cut(s)	165
SmlI	CTYRAG	1 cut(s)	47
SmoI	CTYRAG	1 cut(s)	47
StyD4I	CCNGG	1 cut(s)	73
TfiI	GAWTC	1 cut(s)	88
TseFI	GTSAC	2 cut(s)	184, 203
TseI	GCWGC	1 cut(s)	59
Tsp45I	GTSAC	2 cut(s)	184, 203

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.