Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001521.1

Orthogroup ID

OG0018797

Physical Location & Seq

Genomic Coordinates Forward (+)

22682 .. 23047

Gene Structure 366 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001521.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

atggcggtaaagcttatgcatgcggttcaatacaatagttatggtggaggaccttctggtttaaagcatgttgagattccgatcccaactccgaagaaagatgaggttttgctgaaagtggaagcagctagtataaatccagttgattggaaactgcagaaaggcgtggggcggcctttttacccacgcaatttgccgcatacacctggtaactttgttgttcatttagaatttgagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0009507 GO:0009526 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0009941 GO:0016020 GO:0031967 GO:0031975 GO:0031976 GO:0031984 GO:0034357 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ADH_N ADH_zinc_N_2

Protein Analysis

79

Amino Acids

8.79

Weight (kDa)

9.05

Isoelectric Point (pI)

30.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018797)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g18260 FvH4_2g18300
malus_domestica	MD05G1167100.v1.1
pyrus_communis	pycom10g13560
rosa_multiflora	Rmu_co8075528.1_g000001 Rmu_sc0001521.1_g000008 Rmu_sc0001521.1_g000010 Rmu_sc0002906.1_g000001 Rmu_sc0023365.1_g000004

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	4 cut(s)	5, 23, 172, 197
AclWI	GGATC	1 cut(s)	76
AcsI	RAATTY	1 cut(s)	230
AgsI	TTSAA	1 cut(s)	29
AjnI	CCWGG	1 cut(s)	205
AluBI	AGCT	2 cut(s)	13, 128
AluI	AGCT	2 cut(s)	13, 128
AlwI	GGATC	1 cut(s)	76
AoxI	GGCC	1 cut(s)	173
ApeKI	GCWGC	1 cut(s)	125
ApoI	RAATTY	1 cut(s)	230
AspS9I	GGNCC	1 cut(s)	50
AvaII	GGWCC	1 cut(s)	50
BbvI	GCAGC	1 cut(s)	137
BciT130I	CCWGG	1 cut(s)	207
BfaI	CTAG	1 cut(s)	129
BfmI	CTRYAG	1 cut(s)	155
BisI	GCNGC	3 cut(s)	126, 173, 197
BlsI	GCNGC	3 cut(s)	127, 174, 198
Bme1390I	CCNGG	1 cut(s)	207
Bme18I	GGWCC	1 cut(s)	50
BmgT120I	GGNCC	1 cut(s)	50
BmrFI	CCNGG	1 cut(s)	207
BsaBI	GATNNNNATC	1 cut(s)	80
Bse1I	ACTGG	1 cut(s)	140
Bse8I	GATNNNNATC	1 cut(s)	80
BseBI	CCWGG	1 cut(s)	207
BseJI	GATNNNNATC	1 cut(s)	80
BseNI	ACTGG	1 cut(s)	140
BseXI	GCAGC	1 cut(s)	137
BshFI	GGCC	1 cut(s)	175
BsnI	GGCC	1 cut(s)	175
Bsp143I	GATC	1 cut(s)	81
BspACI	CCGC	4 cut(s)	5, 23, 172, 197
BspANI	GGCC	1 cut(s)	175
BspMAI	CTGCAG	1 cut(s)	159
BspPI	GGATC	1 cut(s)	76
BsrI	ACTGG	1 cut(s)	140
BssMI	GATC	1 cut(s)	81
Bst2UI	CCWGG	1 cut(s)	207
BstC8I	GCNNGC	1 cut(s)	21
BstKTI	GATC	1 cut(s)	84
BstMBI	GATC	1 cut(s)	81
BstNI	CCWGG	1 cut(s)	207
BstNSI	RCATGY	2 cut(s)	23, 71
BstSCI	CCNGG	1 cut(s)	205
BstSFI	CTRYAG	1 cut(s)	155
BstV1I	GCAGC	1 cut(s)	137
BstXI	CCANNNNNNTGG	1 cut(s)	147
BsuRI	GGCC	1 cut(s)	175
Cac8I	GCNNGC	1 cut(s)	21
Cfr13I	GGNCC	1 cut(s)	50
CsiI	ACCWGGT	1 cut(s)	205
CspCI	CAANNNNNGTGG	2 cut(s)	174, 209
CviAII	CATG	2 cut(s)	20, 68
CviJI	RGCY	3 cut(s)	13, 128, 175
CviKI_1	RGCY	3 cut(s)	13, 128, 175
DpnI	GATC	1 cut(s)	83
DpnII	GATC	1 cut(s)	81
DraI	TTTAAA	1 cut(s)	63
Eco47I	GGWCC	1 cut(s)	50
EcoO109I	RGGNCCY	1 cut(s)	50
EcoRII	CCWGG	1 cut(s)	205
EcoT22I	ATGCAT	1 cut(s)	21
FaeI	CATG	2 cut(s)	23, 71
FaiI	YATR	6 cut(s)	17, 21, 42, 69, 134, 201
FatI	CATG	2 cut(s)	19, 67
Fnu4HI	GCNGC	3 cut(s)	126, 173, 197
Fsp4HI	GCNGC	3 cut(s)	126, 173, 197
FspBI	CTAG	1 cut(s)	129
GluI	GCNGC	3 cut(s)	126, 173, 197
HaeIII	GGCC	1 cut(s)	175
Hin1II	CATG	2 cut(s)	23, 71
HindIII	AAGCTT	1 cut(s)	11
HinfI	GANTC	1 cut(s)	76
Hpy188I	TCNGA	2 cut(s)	81, 93
HpyAV	CCTTC	1 cut(s)	63
HpyCH4V	TGCA	2 cut(s)	19, 157
Hsp92II	CATG	2 cut(s)	23, 71
Kzo9I	GATC	1 cut(s)	81
LpnPI	CCDG	4 cut(s)	42, 153, 192, 219
Lsp1109I	GCAGC	1 cut(s)	137
MabI	ACCWGGT	1 cut(s)	205
MaeI	CTAG	1 cut(s)	129
MaeIII	GTNAC	1 cut(s)	209
MalI	GATC	1 cut(s)	83
MboI	GATC	1 cut(s)	81
MboII	GAAGA	1 cut(s)	106
MluCI	AATT	2 cut(s)	190, 230
MnlI	CCTC	2 cut(s)	41, 97
Mph1103I	ATGCAT	1 cut(s)	21
MseI	TTAA	1 cut(s)	62
MspR9I	CCNGG	1 cut(s)	207
MvaI	CCWGG	1 cut(s)	207
NdeII	GATC	1 cut(s)	81
NlaIII	CATG	2 cut(s)	23, 71
NsiI	ATGCAT	1 cut(s)	21
NspI	RCATGY	2 cut(s)	23, 71
PaeI	GCATGC	1 cut(s)	23
PfeI	GAWTC	1 cut(s)	76
PkrI	GCNGC	3 cut(s)	127, 174, 198
PpuMI	RGGWCCY	1 cut(s)	50
Psp5II	RGGWCCY	1 cut(s)	50
Psp6I	CCWGG	1 cut(s)	205
PspGI	CCWGG	1 cut(s)	205
PspPI	GGNCC	1 cut(s)	50
PspPPI	RGGWCCY	1 cut(s)	50
PstI	CTGCAG	1 cut(s)	159
SaqAI	TTAA	1 cut(s)	62
SatI	GCNGC	3 cut(s)	126, 173, 197
Sau3AI	GATC	1 cut(s)	81
Sau96I	GGNCC	1 cut(s)	50
ScrFI	CCNGG	1 cut(s)	207
SetI	ASST	5 cut(s)	15, 55, 108, 130, 208
SexAI	ACCWGGT	1 cut(s)	205
SfcI	CTRYAG	1 cut(s)	155
SgeI	CNNG	9 cut(s)	32, 69, 80, 141, 152, 178, 198, 218, 219
SinI	GGWCC	1 cut(s)	50
SphI	GCATGC	1 cut(s)	23
Sse9I	AATT	2 cut(s)	190, 230
SsiI	CCGC	4 cut(s)	5, 23, 172, 197
SspMI	CTAG	1 cut(s)	129
StyD4I	CCNGG	1 cut(s)	205
TasI	AATT	2 cut(s)	190, 230
TauI	GCSGC	2 cut(s)	175, 199
TfiI	GAWTC	1 cut(s)	76
Tru1I	TTAA	1 cut(s)	62
Tru9I	TTAA	1 cut(s)	62
TseI	GCWGC	1 cut(s)	125
TspDTI	ATGAA	1 cut(s)	212
VpaK11BI	GGWCC	1 cut(s)	50
XapI	RAATTY	1 cut(s)	230
XceI	RCATGY	2 cut(s)	23, 71
XspI	CTAG	1 cut(s)	129
Zsp2I	ATGCAT	1 cut(s)	21

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.