Rmu_co8103216.1_g000001

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8103216.1
Physical Location & Seq
Reverse (-)
2 .. 439
438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8103216.1_g000001.1.cds

Sequence Viewer

Length: 438 bp
atggatttcaccaaagcaacttacttggtattgggggttttgggtcagtatataaaggaacactttgctgatgggattgatgttgccataaaggttttcaatttagatacagaagtggctttcacaagttttgatatggaatgcgaaatgctaagcaacatttgtcatcgaaatcttatcaaagtcatcagttgttgtagtcaaattgatttcaaggttgtgatattgaactacatgcctaatgggagccttgaccattggttgtattctcagaacttttctttgaacatcctgcagaggttgaccatattgattgatgttgcatcgacattggaataccttcatcatggttatgaaatacctattgttcattgtgatttgaagcccaacaacatactactagatgatgatatggtcgcacatgttgctgattttggc

Protein Analysis

146

Amino Acids

16.63

Weight (kDa)

4.73

Isoelectric Point (pI)

31.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 421
AgsI TTSAA 5 cut(s) 100, 214, 229, 286, 382
Asp700I GAANNNNTTC 1 cut(s) 339
BaeI ACNNNNGTAYC 2 cut(s) 99, 132
BccI CCATC 1 cut(s) 65
BfaI CTAG 1 cut(s) 401
BfmI CTRYAG 1 cut(s) 293
BlpI GCTNAGC 1 cut(s) 152
BmiI GGNNCC 1 cut(s) 248
BmsI GCATC 1 cut(s) 332
Bpu1102I GCTNAGC 1 cut(s) 152
BseGI GGATG 1 cut(s) 288
BseMII CTCAG 1 cut(s) 284
BsmI GAATGC 1 cut(s) 146
Bsp1720I GCTNAGC 1 cut(s) 152
BspCNI CTCAG 1 cut(s) 283
BspLI GGNNCC 1 cut(s) 248
BspMAI CTGCAG 1 cut(s) 297
BstAPI GCANNNNNTGC 1 cut(s) 425
BstDEI CTNAG 2 cut(s) 152, 270
BstF5I GGATG 1 cut(s) 288
BstMWI GCNNNNNNNGC 1 cut(s) 425
BstNSI RCATGY 2 cut(s) 238, 425
BstSFI CTRYAG 1 cut(s) 293
BtsCI GGATG 1 cut(s) 288
CviAII CATG 3 cut(s) 235, 347, 422
CviJI RGCY 3 cut(s) 119, 249, 385
CviKI_1 RGCY 3 cut(s) 119, 249, 385
DdeI CTNAG 2 cut(s) 152, 270
FaeI CATG 3 cut(s) 238, 350, 425
FalI AAGNNNNNCTT 2 cut(s) 47, 79
FatI CATG 3 cut(s) 234, 346, 421
FokI GGATG 1 cut(s) 275
FspBI CTAG 1 cut(s) 401
Hin1II CATG 3 cut(s) 238, 350, 425
HincII GTYRAC 1 cut(s) 303
HindII GTYRAC 1 cut(s) 303
Hpy166II GTNNAC 1 cut(s) 303
Hpy188I TCNGA 1 cut(s) 273
Hpy8I GTNNAC 1 cut(s) 303
HpyAV CCTTC 1 cut(s) 350
HpyCH4V TGCA 2 cut(s) 295, 323
HpyF10VI GCNNNNNNNGC 1 cut(s) 425
HpyF3I CTNAG 2 cut(s) 152, 270
Hsp92II CATG 3 cut(s) 238, 350, 425
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 1 cut(s) 305
LweI GCATC 1 cut(s) 332
MaeI CTAG 1 cut(s) 401
MluCI AATT 2 cut(s) 100, 204
MnlI CCTC 1 cut(s) 291
MroXI GAANNNNTTC 1 cut(s) 339
MslI CAYNNNNRTG 1 cut(s) 351
Mva1269I GAATGC 1 cut(s) 146
MwoI GCNNNNNNNGC 1 cut(s) 425
NlaIII CATG 3 cut(s) 238, 350, 425
NlaIV GGNNCC 1 cut(s) 248
NspI RCATGY 2 cut(s) 238, 425
PciI ACATGT 1 cut(s) 421
PctI GAATGC 1 cut(s) 146
PdmI GAANNNNTTC 1 cut(s) 339
PscI ACATGT 1 cut(s) 421
PspN4I GGNNCC 1 cut(s) 248
PstI CTGCAG 1 cut(s) 297
RseI CAYNNNNRTG 1 cut(s) 351
SetI ASST 5 cut(s) 96, 219, 302, 342, 364
SfaNI GCATC 1 cut(s) 332
SfcI CTRYAG 1 cut(s) 293
SgeI CNNG 9 cut(s) 37, 138, 226, 247, 263, 304, 359, 413, 434
SmiMI CAYNNNNRTG 1 cut(s) 351
Sse9I AATT 2 cut(s) 100, 204
SspMI CTAG 1 cut(s) 401
TaqI TCGA 2 cut(s) 169, 326
TasI AATT 2 cut(s) 100, 204
TspDTI ATGAA 3 cut(s) 332, 359, 369
XceI RCATGY 2 cut(s) 238, 425
XmnI GAANNNNTTC 1 cut(s) 339
XspI CTAG 1 cut(s) 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.