Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023439.1

Orthogroup ID

OG0019014

Physical Location & Seq

Genomic Coordinates Reverse (-)

2171 .. 2734

Gene Structure 564 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023439.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

atggatttcaccaaagcaacttacttggtattgggggttttgggtcagtatataaaggaacactttgctgatgggattgatgttgccataaaggttttcaatttagatacagaagtggctttcacaagttttgatatggaatgcgaaatgctaagcaacatttgtcatcgaaatcttatcaaagtcatcagttgttgtagtcaaattgatttcaaggttgtgatattgaactacatgcctaatgggagccttgaccattggttgtattctcagaacttttctttgaacatcctgcagaggttgaccatattgattgatgttgcatcgacattggaataccttcatcatggttatgaaatacctattgttcattgtgatttgaagcccaacaacatactactagatgatgatatggtcgcacatgttgctgattttggcactgcaaaactcttgggtggagattctataactcataccatgaccctagccacaattgggtatatggccgcaggtttgtcctctattgtgaagaatgtaacttataattatgttttcatcatatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04016 ko04064 ko04620 ko04621 ko04624 ko04626 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 ko05169 map04010 map04016 map04064 map04620 map04621 map04624 map04626 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

187

Amino Acids

20.96

Weight (kDa)

5.0

Isoelectric Point (pI)

29.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019014)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0016011 RchiOBHm_Chr5g0042081
rosa_laevigata	RLG00000031816
rosa_multiflora	Rmu_co8103216.1_g000001 Rmu_sc0000299.1_g000023 Rmu_sc0001878.1_g000002 Rmu_sc0021845.1_g000004 Rmu_sc0023439.1_g000002 Rmu_sc0023439.1_g000003

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	543
Acc36I	ACCTGC	1 cut(s)	500
AciI	CCGC	1 cut(s)	507
AcoI	YGGCCR	1 cut(s)	504
AfiI	CCNNNNNNNGG	1 cut(s)	495
AflIII	ACRYGT	1 cut(s)	421
AgsI	TTSAA	5 cut(s)	100, 214, 229, 286, 382
AoxI	GGCC	1 cut(s)	504
Asp700I	GAANNNNTTC	1 cut(s)	339
BaeI	ACNNNNGTAYC	2 cut(s)	99, 132
BccI	CCATC	1 cut(s)	65
BfaI	CTAG	2 cut(s)	401, 485
BfmI	CTRYAG	1 cut(s)	293
BfuAI	ACCTGC	1 cut(s)	500
BisI	GCNGC	1 cut(s)	507
BlpI	GCTNAGC	1 cut(s)	152
BlsI	GCNGC	1 cut(s)	508
BmiI	GGNNCC	1 cut(s)	248
BmsI	GCATC	1 cut(s)	332
Bpu1102I	GCTNAGC	1 cut(s)	152
Bsc4I	CCNNNNNNNGG	1 cut(s)	495
BseGI	GGATG	1 cut(s)	288
BseLI	CCNNNNNNNGG	1 cut(s)	495
BseMII	CTCAG	1 cut(s)	284
BshFI	GGCC	1 cut(s)	506
BslI	CCNNNNNNNGG	1 cut(s)	495
BsmI	GAATGC	1 cut(s)	146
BsnI	GGCC	1 cut(s)	506
Bsp1720I	GCTNAGC	1 cut(s)	152
BspACI	CCGC	1 cut(s)	507
BspANI	GGCC	1 cut(s)	506
BspCNI	CTCAG	1 cut(s)	283
BspLI	GGNNCC	1 cut(s)	248
BspMAI	CTGCAG	1 cut(s)	297
BspMI	ACCTGC	1 cut(s)	500
BstAPI	GCANNNNNTGC	1 cut(s)	425
BstDEI	CTNAG	2 cut(s)	152, 270
BstF5I	GGATG	1 cut(s)	288
BstMWI	GCNNNNNNNGC	1 cut(s)	425
BstNSI	RCATGY	2 cut(s)	238, 425
BstSFI	CTRYAG	1 cut(s)	293
BsuRI	GGCC	1 cut(s)	506
BtsCI	GGATG	1 cut(s)	288
BtsI	GCAGTG	1 cut(s)	438
BtsIMutI	CAGTG	1 cut(s)	438
BveI	ACCTGC	1 cut(s)	500
CviAII	CATG	4 cut(s)	235, 347, 422, 478
CviJI	RGCY	5 cut(s)	119, 249, 385, 488, 506
CviKI_1	RGCY	5 cut(s)	119, 249, 385, 488, 506
DdeI	CTNAG	2 cut(s)	152, 270
EaeI	YGGCCR	1 cut(s)	504
FaeI	CATG	4 cut(s)	238, 350, 425, 481
FalI	AAGNNNNNCTT	2 cut(s)	47, 79
FatI	CATG	4 cut(s)	234, 346, 421, 477
FauNDI	CATATG	1 cut(s)	560
Fnu4HI	GCNGC	1 cut(s)	507
FokI	GGATG	1 cut(s)	275
Fsp4HI	GCNGC	1 cut(s)	507
FspBI	CTAG	2 cut(s)	401, 485
GluI	GCNGC	1 cut(s)	507
HaeIII	GGCC	1 cut(s)	506
Hin1II	CATG	4 cut(s)	238, 350, 425, 481
HincII	GTYRAC	1 cut(s)	303
HindII	GTYRAC	1 cut(s)	303
HinfI	GANTC	1 cut(s)	461
Hpy166II	GTNNAC	1 cut(s)	303
Hpy188I	TCNGA	1 cut(s)	273
Hpy8I	GTNNAC	1 cut(s)	303
HpyAV	CCTTC	1 cut(s)	350
HpyCH4V	TGCA	3 cut(s)	295, 323, 443
HpyF10VI	GCNNNNNNNGC	1 cut(s)	425
HpyF3I	CTNAG	2 cut(s)	152, 270
Hsp92II	CATG	4 cut(s)	238, 350, 425, 481
LmnI	GCTCC	1 cut(s)	246
LpnPI	CCDG	2 cut(s)	305, 495
LweI	GCATC	1 cut(s)	332
MaeI	CTAG	2 cut(s)	401, 485
MaeIII	GTNAC	1 cut(s)	535
MboII	GAAGA	1 cut(s)	541
MfeI	CAATTG	1 cut(s)	492
MluCI	AATT	4 cut(s)	100, 204, 492, 544
MnlI	CCTC	2 cut(s)	291, 529
MroXI	GAANNNNTTC	1 cut(s)	339
MslI	CAYNNNNRTG	1 cut(s)	351
MunI	CAATTG	1 cut(s)	492
Mva1269I	GAATGC	1 cut(s)	146
MwoI	GCNNNNNNNGC	1 cut(s)	425
NdeI	CATATG	1 cut(s)	560
NlaIII	CATG	4 cut(s)	238, 350, 425, 481
NlaIV	GGNNCC	1 cut(s)	248
NspI	RCATGY	2 cut(s)	238, 425
PciI	ACATGT	1 cut(s)	421
PctI	GAATGC	1 cut(s)	146
PdmI	GAANNNNTTC	1 cut(s)	339
PfeI	GAWTC	1 cut(s)	461
PkrI	GCNGC	1 cut(s)	508
PscI	ACATGT	1 cut(s)	421
PsiI	TTATAA	1 cut(s)	543
PspN4I	GGNNCC	1 cut(s)	248
PstI	CTGCAG	1 cut(s)	297
RseI	CAYNNNNRTG	1 cut(s)	351
SatI	GCNGC	1 cut(s)	507
SetI	ASST	6 cut(s)	96, 219, 302, 342, 364, 514
SfaNI	GCATC	1 cut(s)	332
SfcI	CTRYAG	1 cut(s)	293
SmiMI	CAYNNNNRTG	1 cut(s)	351
Sse9I	AATT	4 cut(s)	100, 204, 492, 544
SsiI	CCGC	1 cut(s)	507
SspMI	CTAG	2 cut(s)	401, 485
TaqI	TCGA	2 cut(s)	169, 326
TasI	AATT	4 cut(s)	100, 204, 492, 544
TauI	GCSGC	1 cut(s)	509
TfiI	GAWTC	1 cut(s)	461
TscAI	CASTG	1 cut(s)	445
TspDTI	ATGAA	4 cut(s)	332, 359, 369, 544
TspRI	CASTG	1 cut(s)	445
XceI	RCATGY	2 cut(s)	238, 425
XmnI	GAANNNNTTC	1 cut(s)	339
XspI	CTAG	2 cut(s)	401, 485

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.