Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8180752.1

Orthogroup ID

OG0020079

Physical Location & Seq

Genomic Coordinates Reverse (-)

368 .. 664

Gene Structure 297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8180752.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atgtaccagagaattaccattcctgaaataaagaaccacccatggttcttgaagaatctccccgcagatctgatggatgagatgacgatgggcaaccatttcgaagagcctgatcaaccgatgcagagcattgatacaatcatgcaaataattgctgaggccactataccagcagttggaatccacaatcttagcccgtacctgaatgacaattttgacgacgatgatatggatgacttagattcagaatctgaactagatgttgatagcagtggggaaatagtctatgctatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006970 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009414 GO:0009415 GO:0009628 GO:0009651 GO:0009719 GO:0009725 GO:0009737 GO:0009738 GO:0009739 GO:0009755 GO:0009987 GO:0010029 GO:0010033 GO:0010035 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0032870 GO:0033993 GO:0035556 GO:0036211 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0048580 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051239 GO:0051716 GO:0065007 GO:0070887 GO:0071215 GO:0071229 GO:0071310 GO:0071396 GO:0071495 GO:0071704 GO:0097305 GO:0097306 GO:0140096 GO:1900140 GO:1901564 GO:1901700 GO:1901701 GO:2000026

KEGG Pathways

Metabolic & Signaling

ko04016 ko04075 map04016 map04075

Pfam Domains

Protein Families

Pkinase

Protein Analysis

98

Amino Acids

11.19

Weight (kDa)

4.05

Isoelectric Point (pI)

41.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020079)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8180752.1_g000001 Rmu_sc0011974.1_g000001
rosa_samantha	Rh2AG172000 Rh2BG179600 Rh2CG177100 Rh6CG092200 Rh7BG442200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	176
AciI	CCGC	1 cut(s)	63
AfaI	GTAC	2 cut(s)	5, 200
AfiI	CCNNNNNNNGG	1 cut(s)	176
AgsI	TTSAA	1 cut(s)	52
AlwNI	CAGNNNCTG	1 cut(s)	251
AoxI	GGCC	1 cut(s)	159
AsuII	TTCGAA	1 cut(s)	102
BbvCI	CCTCAGC	1 cut(s)	156
BccI	CCATC	2 cut(s)	67, 82
BcgI	CGANNNNNNTGC	2 cut(s)	82, 116
BclI	TGATCA	1 cut(s)	112
BfaI	CTAG	1 cut(s)	257
BglII	AGATCT	1 cut(s)	67
BmsI	GCATC	1 cut(s)	111
Bpu10I	CCTNAGC	1 cut(s)	156
Bpu14I	TTCGAA	1 cut(s)	102
BsaJI	CCNNGG	1 cut(s)	41
Bsc4I	CCNNNNNNNGG	1 cut(s)	176
BseDI	CCNNGG	1 cut(s)	41
BseGI	GGATG	2 cut(s)	82, 238
BseLI	CCNNNNNNNGG	1 cut(s)	176
BseMII	CTCAG	1 cut(s)	147
BshFI	GGCC	1 cut(s)	161
BslI	CCNNNNNNNGG	1 cut(s)	176
BsnI	GGCC	1 cut(s)	161
Bsp119I	TTCGAA	1 cut(s)	102
Bsp143I	GATC	2 cut(s)	67, 112
Bsp19I	CCATGG	1 cut(s)	41
BspACI	CCGC	1 cut(s)	63
BspANI	GGCC	1 cut(s)	161
BspCNI	CTCAG	1 cut(s)	148
BspQI	GCTCTTC	1 cut(s)	99
BspT104I	TTCGAA	1 cut(s)	102
BssECI	CCNNGG	1 cut(s)	41
BssMI	GATC	2 cut(s)	67, 112
BssT1I	CCWWGG	1 cut(s)	41
Bst6I	CTCTTC	1 cut(s)	99
BstBI	TTCGAA	1 cut(s)	102
BstDEI	CTNAG	3 cut(s)	156, 191, 238
BstDSI	CCRYGG	1 cut(s)	41
BstF5I	GGATG	2 cut(s)	82, 238
BstKTI	GATC	2 cut(s)	70, 115
BstMBI	GATC	2 cut(s)	67, 112
BstX2I	RGATCY	1 cut(s)	67
BstYI	RGATCY	1 cut(s)	67
BsuRI	GGCC	1 cut(s)	161
BtgI	CCRYGG	1 cut(s)	41
BtsCI	GGATG	2 cut(s)	82, 238
BtsI	GCAGTG	1 cut(s)	277
BtsIMutI	CAGTG	1 cut(s)	277
CaiI	CAGNNNCTG	1 cut(s)	251
Csp6I	GTAC	2 cut(s)	4, 199
CviAII	CATG	2 cut(s)	42, 142
CviJI	RGCY	3 cut(s)	109, 161, 195
CviKI_1	RGCY	3 cut(s)	109, 161, 195
CviQI	GTAC	2 cut(s)	4, 199
DdeI	CTNAG	3 cut(s)	156, 191, 238
DpnI	GATC	2 cut(s)	69, 114
DpnII	GATC	2 cut(s)	67, 112
Eam1104I	CTCTTC	1 cut(s)	99
EarI	CTCTTC	1 cut(s)	99
Eco130I	CCWWGG	1 cut(s)	41
EcoT14I	CCWWGG	1 cut(s)	41
ErhI	CCWWGG	1 cut(s)	41
FaeI	CATG	2 cut(s)	45, 145
FaiI	YATR	5 cut(s)	43, 143, 167, 230, 288
FatI	CATG	2 cut(s)	41, 141
FauI	CCCGC	1 cut(s)	70
FbaI	TGATCA	1 cut(s)	112
FokI	GGATG	2 cut(s)	89, 245
FspBI	CTAG	1 cut(s)	257
HaeIII	GGCC	1 cut(s)	161
Hin1II	CATG	2 cut(s)	45, 145
HinfI	GANTC	4 cut(s)	55, 180, 242, 248
Hpy188I	TCNGA	3 cut(s)	72, 247, 253
Hpy188III	TCNNGA	2 cut(s)	23, 49
Hpy99I	CGWCG	1 cut(s)	224
HpyCH4V	TGCA	2 cut(s)	124, 145
HpyF3I	CTNAG	3 cut(s)	156, 191, 238
Hsp92II	CATG	2 cut(s)	45, 145
Ksp22I	TGATCA	1 cut(s)	112
Kzo9I	GATC	2 cut(s)	67, 112
LguI	GCTCTTC	1 cut(s)	99
LpnPI	CCDG	5 cut(s)	20, 36, 123, 183, 215
LweI	GCATC	1 cut(s)	111
MaeI	CTAG	1 cut(s)	257
MalI	GATC	2 cut(s)	69, 114
MboI	GATC	2 cut(s)	67, 112
MboII	GAAGA	2 cut(s)	64, 116
MflI	RGATCY	1 cut(s)	67
MluCI	AATT	3 cut(s)	12, 150, 211
MmeI	TCCRAC	1 cut(s)	157
MnlI	CCTC	1 cut(s)	151
MseI	TTAA	1 cut(s)	295
NcoI	CCATGG	1 cut(s)	41
NdeII	GATC	2 cut(s)	67, 112
NlaIII	CATG	2 cut(s)	45, 145
NspV	TTCGAA	1 cut(s)	102
PciSI	GCTCTTC	1 cut(s)	99
PfeI	GAWTC	4 cut(s)	55, 180, 242, 248
PflMI	CCANNNNNTGG	1 cut(s)	176
PstNI	CAGNNNCTG	1 cut(s)	251
PsuI	RGATCY	1 cut(s)	67
RsaI	GTAC	2 cut(s)	5, 200
RsaNI	GTAC	2 cut(s)	4, 199
SapI	GCTCTTC	1 cut(s)	99
SaqAI	TTAA	1 cut(s)	295
Sau3AI	GATC	2 cut(s)	67, 112
SetI	ASST	1 cut(s)	204
SfaNI	GCATC	1 cut(s)	111
SfuI	TTCGAA	1 cut(s)	102
Sse9I	AATT	3 cut(s)	12, 150, 211
SsiI	CCGC	1 cut(s)	63
SspMI	CTAG	1 cut(s)	257
StyI	CCWWGG	1 cut(s)	41
TaqI	TCGA	1 cut(s)	102
TasI	AATT	3 cut(s)	12, 150, 211
TfiI	GAWTC	4 cut(s)	55, 180, 242, 248
Tru1I	TTAA	1 cut(s)	295
Tru9I	TTAA	1 cut(s)	295
TscAI	CASTG	1 cut(s)	277
TspRI	CASTG	1 cut(s)	277
Van91I	CCANNNNNTGG	1 cut(s)	176
XspI	CTAG	1 cut(s)	257

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.