Rh7BG442200
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
51093398 .. 51104810
11413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG442200.1

Sequence Viewer

Length: 240 bp
ATGGAGAAGTATGAGGTTGTGAAAGATATTGGGTCTGGGAATTTTGGTGTAGCAAGGCTGGTCAGAGACAAGAATACCCAAGAACTCTTAGCTGTTAAGTTCATTGAGAGAGGCCTTAAGGAAAAAGGTGAAAGAATCCACTCTTTTTCAAACCCACAAGCTTCACAGCCCCATCAACCCATCAAAAACCCGAATCAGAGCCTGAATGTCCACAAACACAGTGTTGCAAATCTCAACTAG

Protein Analysis

79

Amino Acids

8.92

Weight (kDa)

9.7

Isoelectric Point (pI)

23.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020079)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 40
AflII CTTAAG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 150
AluBI AGCT 2 cut(s) 92, 161
AluI AGCT 2 cut(s) 92, 161
Alw26I GTCTC 1 cut(s) 60
AlwNI CAGNNNCTG 1 cut(s) 202
AoxI GGCC 1 cut(s) 112
ApoI RAATTY 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 140
BccI CCATC 2 cut(s) 180, 188
BcoDI GTCTC 1 cut(s) 60
BfaI CTAG 1 cut(s) 238
BfrI CTTAAG 1 cut(s) 116
BshFI GGCC 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 60
BsnI GGCC 1 cut(s) 114
BspANI GGCC 1 cut(s) 114
BspTI CTTAAG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 221
BstAFI CTTAAG 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 88
BstMAI GTCTC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 226
CaiI CAGNNNCTG 1 cut(s) 202
CviJI RGCY 6 cut(s) 58, 92, 114, 161, 169, 201
CviKI_1 RGCY 6 cut(s) 58, 92, 114, 161, 169, 201
DdeI CTNAG 1 cut(s) 88
Eco147I AGGCCT 1 cut(s) 114
FaiI YATR 1 cut(s) 12
FspBI CTAG 1 cut(s) 238
HaeIII GGCC 1 cut(s) 114
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 2 cut(s) 135, 193
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 1 cut(s) 211
Hpy188I TCNGA 2 cut(s) 65, 198
Hpy8I GTNNAC 1 cut(s) 211
HpyCH4III ACNGT 1 cut(s) 221
HpyCH4V TGCA 1 cut(s) 227
HpyF3I CTNAG 1 cut(s) 88
LpnPI CCDG 3 cut(s) 21, 44, 215
MaeI CTAG 1 cut(s) 238
MluCI AATT 1 cut(s) 40
MnlI CCTC 2 cut(s) 7, 104
MseI TTAA 2 cut(s) 96, 117
MspCI CTTAAG 1 cut(s) 116
PceI AGGCCT 1 cut(s) 114
PfeI GAWTC 2 cut(s) 135, 193
PstNI CAGNNNCTG 1 cut(s) 202
SaqAI TTAA 2 cut(s) 96, 117
SetI ASST 4 cut(s) 18, 94, 130, 163
SgeI CNNG 8 cut(s) 48, 66, 71, 82, 92, 170, 202, 214
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 40
SseBI AGGCCT 1 cut(s) 114
SspMI CTAG 1 cut(s) 238
StuI AGGCCT 1 cut(s) 114
TaaI ACNGT 1 cut(s) 221
TasI AATT 1 cut(s) 40
TfiI GAWTC 2 cut(s) 135, 193
Tru1I TTAA 2 cut(s) 96, 117
Tru9I TTAA 2 cut(s) 96, 117
TscAI CASTG 1 cut(s) 226
TspDTI ATGAA 1 cut(s) 91
TspRI CASTG 1 cut(s) 226
Vha464I CTTAAG 1 cut(s) 116
XapI RAATTY 1 cut(s) 40
XspI CTAG 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.