Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011974.1

Orthogroup ID

OG0020079

Physical Location & Seq

Genomic Coordinates Forward (+)

185 .. 538

Gene Structure 354 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011974.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

atgtatggacacaggaattttctaattttgaatctggttgaatgtcattgtctgcaacagaggataacaattcctgaaattaggaaccatgagtggtttctaaaaaaccttccagcagatctcatggttgaaaacacgatgaacagccagtttgaagagcctgatcaacccatgcaaagcatagatgagatcatgcagataattgctgaggctacaataccggcggctgggaccaacaatctcaaccagtatcttgcgggcagcctggacatcgacaacatggaggaggatcttgatacagatcctgacgaccttgacatcgacagcagcggggaaatagtctatgcaatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009719 GO:0009725 GO:0009737 GO:0009738 GO:0009755 GO:0009987 GO:0010033 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0032870 GO:0033993 GO:0035556 GO:0036211 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0070887 GO:0071215 GO:0071229 GO:0071310 GO:0071396 GO:0071495 GO:0071704 GO:0097305 GO:0097306 GO:0140096 GO:1901564 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

ko04016 ko04075 map04016 map04075

Pfam Domains

Protein Families

Pkinase

Protein Analysis

117

Amino Acids

13.35

Weight (kDa)

4.05

Isoelectric Point (pI)

44.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020079)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8180752.1_g000001 Rmu_sc0011974.1_g000001
rosa_samantha	Rh2AG172000 Rh2BG179600 Rh2CG177100 Rh6CG092200 Rh7BG442200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	224, 257, 330
AclWI	GGATC	2 cut(s)	296, 297
AcsI	RAATTY	1 cut(s)	16
AfiI	CCNNNNNNNGG	1 cut(s)	227
AgsI	TTSAA	4 cut(s)	31, 41, 131, 155
AjnI	CCWGG	1 cut(s)	264
AlwI	GGATC	2 cut(s)	296, 297
AlwNI	CAGNNNCTG	1 cut(s)	305
ApeKI	GCWGC	2 cut(s)	261, 327
ApoI	RAATTY	1 cut(s)	16
AspS9I	GGNCC	1 cut(s)	231
AvaII	GGWCC	1 cut(s)	231
BbvCI	CCTCAGC	1 cut(s)	207
BbvI	GCAGC	2 cut(s)	273, 339
BciT130I	CCWGG	1 cut(s)	266
BclI	TGATCA	1 cut(s)	163
BglII	AGATCT	1 cut(s)	118
BisI	GCNGC	3 cut(s)	225, 262, 328
BlsI	GCNGC	3 cut(s)	226, 263, 329
Bme1390I	CCNGG	1 cut(s)	266
Bme18I	GGWCC	1 cut(s)	231
BmgT120I	GGNCC	1 cut(s)	231
BmiI	GGNNCC	2 cut(s)	86, 232
BmrFI	CCNGG	1 cut(s)	266
Bpu10I	CCTNAGC	1 cut(s)	207
BsaBI	GATNNNNATC	1 cut(s)	300
Bsc4I	CCNNNNNNNGG	1 cut(s)	227
Bse118I	RCCGGY	1 cut(s)	220
Bse1I	ACTGG	2 cut(s)	148, 247
Bse8I	GATNNNNATC	1 cut(s)	300
BseBI	CCWGG	1 cut(s)	266
BseJI	GATNNNNATC	1 cut(s)	300
BseLI	CCNNNNNNNGG	1 cut(s)	227
BseMII	CTCAG	1 cut(s)	198
BseNI	ACTGG	2 cut(s)	148, 247
BseRI	GAGGAG	1 cut(s)	299
BseXI	GCAGC	2 cut(s)	273, 339
BseYI	CCCAGC	1 cut(s)	227
BsiSI	CCGG	1 cut(s)	221
BslFI	GGGAC	1 cut(s)	244
BslI	CCNNNNNNNGG	1 cut(s)	227
BsmFI	GGGAC	1 cut(s)	244
Bsp143I	GATC	5 cut(s)	118, 163, 189, 289, 301
BspACI	CCGC	3 cut(s)	224, 257, 330
BspCNI	CTCAG	1 cut(s)	199
BspLI	GGNNCC	2 cut(s)	86, 232
BspPI	GGATC	2 cut(s)	296, 297
BspQI	GCTCTTC	1 cut(s)	150
BsrFI	RCCGGY	1 cut(s)	220
BsrI	ACTGG	2 cut(s)	148, 247
BssAI	RCCGGY	1 cut(s)	220
BssMI	GATC	5 cut(s)	118, 163, 189, 289, 301
Bst2UI	CCWGG	1 cut(s)	266
Bst6I	CTCTTC	1 cut(s)	150
BstC8I	GCNNGC	1 cut(s)	259
BstDEI	CTNAG	1 cut(s)	207
BstKTI	GATC	5 cut(s)	121, 166, 192, 292, 304
BstMBI	GATC	5 cut(s)	118, 163, 189, 289, 301
BstNI	CCWGG	1 cut(s)	266
BstSCI	CCNGG	1 cut(s)	264
BstV1I	GCAGC	2 cut(s)	273, 339
BstX2I	RGATCY	3 cut(s)	118, 289, 301
BstYI	RGATCY	3 cut(s)	118, 289, 301
Cac8I	GCNNGC	1 cut(s)	259
CaiI	CAGNNNCTG	1 cut(s)	305
Cfr10I	RCCGGY	1 cut(s)	220
Cfr13I	GGNCC	1 cut(s)	231
CviAII	CATG	5 cut(s)	89, 124, 172, 193, 280
CviJI	RGCY	5 cut(s)	147, 160, 212, 227, 264
CviKI_1	RGCY	5 cut(s)	147, 160, 212, 227, 264
DdeI	CTNAG	1 cut(s)	207
DpnI	GATC	5 cut(s)	120, 165, 191, 291, 303
DpnII	GATC	5 cut(s)	118, 163, 189, 289, 301
Eam1104I	CTCTTC	1 cut(s)	150
EarI	CTCTTC	1 cut(s)	150
Eco47I	GGWCC	1 cut(s)	231
EcoRII	CCWGG	1 cut(s)	264
FaeI	CATG	5 cut(s)	92, 127, 175, 196, 283
FaiI	YATR	8 cut(s)	6, 90, 125, 173, 182, 194, 281, 345
FaqI	GGGAC	1 cut(s)	244
FatI	CATG	5 cut(s)	88, 123, 171, 192, 279
FauI	CCCGC	2 cut(s)	250, 323
FbaI	TGATCA	1 cut(s)	163
Fnu4HI	GCNGC	3 cut(s)	225, 262, 328
Fsp4HI	GCNGC	3 cut(s)	225, 262, 328
GluI	GCNGC	3 cut(s)	225, 262, 328
GsaI	CCCAGC	1 cut(s)	231
HapII	CCGG	1 cut(s)	221
Hin1II	CATG	5 cut(s)	92, 127, 175, 196, 283
HinfI	GANTC	1 cut(s)	31
HpaII	CCGG	1 cut(s)	221
Hpy188III	TCNNGA	3 cut(s)	74, 293, 305
HpyAV	CCTTC	1 cut(s)	119
HpyCH4V	TGCA	4 cut(s)	55, 175, 196, 347
HpyF3I	CTNAG	1 cut(s)	207
Hsp92II	CATG	5 cut(s)	92, 127, 175, 196, 283
Ksp22I	TGATCA	1 cut(s)	163
Kzo9I	GATC	5 cut(s)	118, 163, 189, 289, 301
LguI	GCTCTTC	1 cut(s)	150
Lsp1109I	GCAGC	2 cut(s)	273, 339
MalI	GATC	5 cut(s)	120, 165, 191, 291, 303
MboI	GATC	5 cut(s)	118, 163, 189, 289, 301
MboII	GAAGA	1 cut(s)	167
MflI	RGATCY	3 cut(s)	118, 289, 301
MluCI	AATT	6 cut(s)	16, 24, 69, 78, 201, 348
MnlI	CCTC	4 cut(s)	54, 202, 277, 280
MspA1I	CMGCKG	1 cut(s)	330
MspI	CCGG	1 cut(s)	221
MspR9I	CCNGG	1 cut(s)	266
MvaI	CCWGG	1 cut(s)	266
NdeII	GATC	5 cut(s)	118, 163, 189, 289, 301
NlaIII	CATG	5 cut(s)	92, 127, 175, 196, 283
NlaIV	GGNNCC	2 cut(s)	86, 232
PciSI	GCTCTTC	1 cut(s)	150
PfeI	GAWTC	1 cut(s)	31
PkrI	GCNGC	3 cut(s)	226, 263, 329
Psp6I	CCWGG	1 cut(s)	264
PspFI	CCCAGC	1 cut(s)	227
PspGI	CCWGG	1 cut(s)	264
PspN4I	GGNNCC	2 cut(s)	86, 232
PspPI	GGNCC	1 cut(s)	231
PstNI	CAGNNNCTG	1 cut(s)	305
PsuI	RGATCY	3 cut(s)	118, 289, 301
SapI	GCTCTTC	1 cut(s)	150
SatI	GCNGC	3 cut(s)	225, 262, 328
Sau3AI	GATC	5 cut(s)	118, 163, 189, 289, 301
Sau96I	GGNCC	1 cut(s)	231
ScrFI	CCNGG	1 cut(s)	266
SetI	ASST	2 cut(s)	111, 315
SinI	GGWCC	1 cut(s)	231
Sse9I	AATT	6 cut(s)	16, 24, 69, 78, 201, 348
SsiI	CCGC	3 cut(s)	224, 257, 330
StyD4I	CCNGG	1 cut(s)	264
TaqI	TCGA	2 cut(s)	273, 321
TasI	AATT	6 cut(s)	16, 24, 69, 78, 201, 348
TauI	GCSGC	1 cut(s)	227
TfiI	GAWTC	1 cut(s)	31
TseI	GCWGC	2 cut(s)	261, 327
TspDTI	ATGAA	1 cut(s)	155
VpaK11BI	GGWCC	1 cut(s)	231
XapI	RAATTY	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.