Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8197360.1

Orthogroup ID

OG0007970

Physical Location & Seq

Genomic Coordinates Forward (+)

82 .. 707

Gene Structure 626 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8197360.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 626 bp

atgtcgcaagctaatgaagataatgatctcctggagcctctaagtaatttgagatctaaactttcaaagaatgcaaaggccaagactaaaagcaagcgtgtgaaaaaaggtgcctctaccatctctcaaaatgccacaataactatcaaatcagaacagatcccaagcgagcaggagctactccaattcaatcaggttacgcctgcatgcgagagggacattgaagtagatgttcctgaacctggttgttcggatgtccaaaacacaagctgttttgatgatgatacctctttggtttatgacaatatggtgagttattatggagtagtgccaactgaattccctatgacagctgctgaattgtcaatttctccaacagatgaaaatcagagctgcattgtttatgaaccattttgtgaagatatggagtatgatcctatgccacttcaggttgtaagcaactcaggttgggatatagtcaaggcagatgatactgagataaccaattaccagtgtttagatttttggcctgcattagaatctaggattcaaggatatatcaccaattcagttcaccctgacctcattgaagcaatatcttcagatgacactatttcctctgagga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

208

Amino Acids

23.15

Weight (kDa)

4.11

Isoelectric Point (pI)

52.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007970)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G56870 AT3G56870
fragaria_vesca	FvH4_2g39990 FvH4_2g39990 FvH4_2g39990 FvH4_2g39990 FvH4_2g39990
malus_domestica	MD08G1033800.v1.1 MD15G1030400.v1.1
prunus_persica	Prupe.1G381200_v2.0.a1
pyrus_communis	pycom08g02700 pycom15g02670
rosa_chinensis	RchiOBHm_Chr6g0300761
rosa_laevigata	RLG00000011304
rosa_multiflora	Rmu_co8197360.1_g000001 Rmu_sc0003626.1_g000001 Rmu_sc0026201.1_g000001
rosa_roxburghii	Rroxscaffold_7G00167440
rosa_rugosa	Rorug06G0298900 Rorug06G0299000
rosa_samantha	Rh6AG411800 Rh6BG419000 Rh6CG426500 Rh6DG411900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	110
AclWI	GGATC	2 cut(s)	154, 428
AcsI	RAATTY	1 cut(s)	338
AcuI	CTGAAG	2 cut(s)	431, 585
AfiI	CCNNNNNNNGG	1 cut(s)	242
AgsI	TTSAA	5 cut(s)	66, 190, 224, 551, 590
AjnI	CCWGG	2 cut(s)	30, 241
AluBI	AGCT	5 cut(s)	11, 178, 270, 353, 393
AluI	AGCT	5 cut(s)	11, 178, 270, 353, 393
AlwI	GGATC	2 cut(s)	154, 428
AlwNI	CAGNNNCTG	1 cut(s)	356
AoxI	GGCC	2 cut(s)	78, 527
ApeKI	GCWGC	2 cut(s)	353, 393
ApoI	RAATTY	1 cut(s)	338
AsuHPI	GGTGA	3 cut(s)	322, 553, 566
BanI	GGYRCC	1 cut(s)	110
BbvI	GCAGC	2 cut(s)	340, 380
BccI	CCATC	1 cut(s)	128
BciT130I	CCWGG	2 cut(s)	32, 243
BfaI	CTAG	1 cut(s)	543
BglII	AGATCT	1 cut(s)	53
BisI	GCNGC	2 cut(s)	354, 394
BlsI	GCNGC	2 cut(s)	355, 395
Bme1390I	CCNGG	2 cut(s)	32, 243
BmiI	GGNNCC	2 cut(s)	36, 112
BmrFI	CCNGG	2 cut(s)	32, 243
BpmI	CTGGAG	1 cut(s)	53
BsaBI	GATNNNNATC	2 cut(s)	24, 384
Bsc4I	CCNNNNNNNGG	1 cut(s)	242
Bse1I	ACTGG	1 cut(s)	511
Bse8I	GATNNNNATC	2 cut(s)	24, 384
BseBI	CCWGG	2 cut(s)	32, 243
BseGI	GGATG	1 cut(s)	259
BseJI	GATNNNNATC	2 cut(s)	24, 384
BseLI	CCNNNNNNNGG	1 cut(s)	242
BseMII	CTCAG	3 cut(s)	477, 486, 612
BseNI	ACTGG	1 cut(s)	511
BseXI	GCAGC	2 cut(s)	340, 380
BshFI	GGCC	2 cut(s)	80, 529
BshNI	GGYRCC	1 cut(s)	110
BslFI	GGGAC	1 cut(s)	230
BslI	CCNNNNNNNGG	1 cut(s)	242
BsmFI	GGGAC	1 cut(s)	230
BsmI	GAATGC	1 cut(s)	76
BsnI	GGCC	2 cut(s)	80, 529
Bsp143I	GATC	4 cut(s)	25, 53, 159, 433
BspANI	GGCC	2 cut(s)	80, 529
BspCNI	CTCAG	3 cut(s)	476, 487, 613
BspLI	GGNNCC	2 cut(s)	36, 112
BspPI	GGATC	2 cut(s)	154, 428
BspT107I	GGYRCC	1 cut(s)	110
BsrI	ACTGG	1 cut(s)	511
BssMI	GATC	4 cut(s)	25, 53, 159, 433
Bst2UI	CCWGG	2 cut(s)	32, 243
BstC8I	GCNNGC	6 cut(s)	9, 95, 170, 204, 208, 531
BstDEI	CTNAG	4 cut(s)	41, 463, 495, 621
BstF5I	GGATG	1 cut(s)	259
BstKTI	GATC	4 cut(s)	28, 56, 162, 436
BstMBI	GATC	4 cut(s)	25, 53, 159, 433
BstNI	CCWGG	2 cut(s)	32, 243
BstNSI	RCATGY	1 cut(s)	210
BstSCI	CCNGG	2 cut(s)	30, 241
BstV1I	GCAGC	2 cut(s)	340, 380
BstX2I	RGATCY	2 cut(s)	53, 159
BstYI	RGATCY	2 cut(s)	53, 159
BsuRI	GGCC	2 cut(s)	80, 529
BtsCI	GGATG	1 cut(s)	259
BtsIMutI	CAGTG	1 cut(s)	518
Cac8I	GCNNGC	6 cut(s)	9, 95, 170, 204, 208, 531
CaiI	CAGNNNCTG	1 cut(s)	356
CsiI	ACCWGGT	1 cut(s)	241
CviAII	CATG	1 cut(s)	207
CviJI	RGCY	8 cut(s)	11, 37, 80, 178, 270, 353, 393, 529
CviKI_1	RGCY	8 cut(s)	11, 37, 80, 178, 270, 353, 393, 529
DdeI	CTNAG	4 cut(s)	41, 463, 495, 621
DpnI	GATC	4 cut(s)	27, 55, 161, 435
DpnII	GATC	4 cut(s)	25, 53, 159, 433
Eco57I	CTGAAG	2 cut(s)	431, 585
EcoRI	GAATTC	1 cut(s)	338
EcoRII	CCWGG	2 cut(s)	30, 241
FaeI	CATG	1 cut(s)	210
FaqI	GGGAC	1 cut(s)	230
FatI	CATG	1 cut(s)	206
Fnu4HI	GCNGC	2 cut(s)	354, 394
FokI	GGATG	1 cut(s)	266
Fsp4HI	GCNGC	2 cut(s)	354, 394
FspBI	CTAG	1 cut(s)	543
GluI	GCNGC	2 cut(s)	354, 394
GsuI	CTGGAG	1 cut(s)	53
HaeIII	GGCC	2 cut(s)	80, 529
Hin1II	CATG	1 cut(s)	210
HinfI	GANTC	2 cut(s)	539, 547
HphI	GGTGA	3 cut(s)	322, 553, 566
Hpy166II	GTNNAC	1 cut(s)	574
Hpy188I	TCNGA	5 cut(s)	154, 253, 390, 604, 622
Hpy188III	TCNNGA	1 cut(s)	236
Hpy8I	GTNNAC	1 cut(s)	574
HpyCH4V	TGCA	4 cut(s)	74, 206, 396, 533
HpyF3I	CTNAG	4 cut(s)	41, 463, 495, 621
Hsp92II	CATG	1 cut(s)	210
Kzo9I	GATC	4 cut(s)	25, 53, 159, 433
LmnI	GCTCC	2 cut(s)	34, 175
Lsp1109I	GCAGC	2 cut(s)	340, 380
MabI	ACCWGGT	1 cut(s)	241
MaeI	CTAG	1 cut(s)	543
MaeIII	GTNAC	1 cut(s)	196
MalI	GATC	4 cut(s)	27, 55, 161, 435
MboI	GATC	4 cut(s)	25, 53, 159, 433
MboII	GAAGA	3 cut(s)	29, 431, 591
MflI	RGATCY	2 cut(s)	53, 159
MluCI	AATT	7 cut(s)	46, 185, 338, 359, 366, 505, 565
MmeI	TCCRAC	1 cut(s)	398
MnlI	CCTC	6 cut(s)	48, 124, 207, 298, 593, 616
MspA1I	CMGCKG	1 cut(s)	353
MspR9I	CCNGG	2 cut(s)	32, 243
Mva1269I	GAATGC	1 cut(s)	76
MvaI	CCWGG	2 cut(s)	32, 243
NdeII	GATC	4 cut(s)	25, 53, 159, 433
NlaIII	CATG	1 cut(s)	210
NlaIV	GGNNCC	2 cut(s)	36, 112
NspI	RCATGY	1 cut(s)	210
PaeI	GCATGC	1 cut(s)	210
PctI	GAATGC	1 cut(s)	76
PfeI	GAWTC	2 cut(s)	539, 547
PfoI	TCCNGGA	1 cut(s)	30
PkrI	GCNGC	2 cut(s)	355, 395
Psp6I	CCWGG	2 cut(s)	30, 241
PspGI	CCWGG	2 cut(s)	30, 241
PspN4I	GGNNCC	2 cut(s)	36, 112
PstNI	CAGNNNCTG	1 cut(s)	356
PsuI	RGATCY	2 cut(s)	53, 159
PvuII	CAGCTG	1 cut(s)	353
SatI	GCNGC	2 cut(s)	354, 394
Sau3AI	GATC	4 cut(s)	25, 53, 159, 433
ScrFI	CCNGG	2 cut(s)	32, 243
SexAI	ACCWGGT	1 cut(s)	241
SphI	GCATGC	1 cut(s)	210
Sse9I	AATT	7 cut(s)	46, 185, 338, 359, 366, 505, 565
SspMI	CTAG	1 cut(s)	543
StyD4I	CCNGG	2 cut(s)	30, 241
TasI	AATT	7 cut(s)	46, 185, 338, 359, 366, 505, 565
TfiI	GAWTC	2 cut(s)	539, 547
TscAI	CASTG	1 cut(s)	518
TseI	GCWGC	2 cut(s)	353, 393
TspDTI	ATGAA	3 cut(s)	30, 396, 420
TspRI	CASTG	1 cut(s)	518
XapI	RAATTY	1 cut(s)	338
XceI	RCATGY	1 cut(s)	210
XspI	CTAG	1 cut(s)	543

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.