Rmu_sc0003626.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003626.1
OG0007970
Physical Location & Seq
Forward (+)
1 .. 2626
2626 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003626.1_g000001.1.cds

Sequence Viewer

Length: 1219 bp
gattcaaggatatatcaccaattcagttcaccctgacctcattgaagcaatatcttcagatgacactatttcctctgaggatgcattgttatgtcagattaacagtgagaccaaagatggtttatttcagtgcacggaaccaattaagggatctgatgcatgtacatctgatgcctatagcaaaggtgatttaccttctaatcaggaagccagtgctaactctgttggtgattgtgacttgggctctggtagctgtttggtgtctgtggctgatcacgtttccatgtcaaaggaagaggagaagcaatctcaattgtttgcatgtgctgatgcaaaaataagcttgtctcctggggtcatttcatgtgaggctagtgatgagtgtacagcagcagctagtggtgggtacttaaagcagcagcttcctcaaaggcttttcccaacaagaaaggccatttcaccagcttcccaagaaaaattgtgcaaggctatgaagtcaattgagttacaggatggacatagcgcgtgcaaggggaaactatgttttggaaaacatactgagagtacaaaccacggcgctgattggcagcctaatcagatcaggagacctaggttctctattacaccggaaaccattaggaatcccaagaatgagaagattggttcgcatcctagaggcatccctaaagcttctaatggttcttcaactgcaccaccacgttttagtacagggtgtacatccattcgaacctgttcagacagtgccattgcattctcacaacgccagatgcatgacattgaatgtatcacaacaaaactcacaaatgaattacagaccatgaaggaaattgcagaagaaagattattgttcggaccctatcctaccacatcactgaaatataatgctgatgaggttagaatggccattcagaatgtaacacgagttgaggcttctgctaaaaagttgctctcgatgatgtcaagggactgtagccgattttgtaaaatcatgagaatggctgatcagaatgattctaatgattccgaagacgttggaaacaatcacccaaaaacaactgttgtaaacaaggagaggaagaagattacttttgctgatgaagctggggaaaagctgtgccatgtcaagatttttgagaatgagatgatatcatcttcggtaactggtccttctcaaaaccaggaattgctggttaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

405

Amino Acids

44.13

Weight (kDa)

5.93

Isoelectric Point (pI)

48.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 525
AclWI GGATC 1 cut(s) 158
AcoI YGGCCR 1 cut(s) 922
AcuI CTGAAG 1 cut(s) 40
AfaI GTAC 6 cut(s) 164, 386, 408, 566, 728, 737
AfiI CCNNNNNNNGG 1 cut(s) 147
AgsI TTSAA 4 cut(s) 6, 45, 706, 801
AjnI CCWGG 2 cut(s) 350, 1198
AluBI AGCT 8 cut(s) 253, 343, 396, 422, 465, 690, 1122, 1133
AluI AGCT 8 cut(s) 253, 343, 396, 422, 465, 690, 1122, 1133
Alw21I GWGCWC 1 cut(s) 135
Alw26I GTCTC 3 cut(s) 102, 352, 599
Alw44I GTGCAC 1 cut(s) 131
AlwI GGATC 1 cut(s) 158
AoxI GGCC 2 cut(s) 451, 922
ApaLI GTGCAC 1 cut(s) 131
ApeKI GCWGC 5 cut(s) 390, 393, 416, 419, 587
Asp700I GAANNNNTTC 1 cut(s) 752
AspA2I CCTAGG 1 cut(s) 609
AspLEI GCGC 2 cut(s) 525, 579
AspS9I GGNCC 2 cut(s) 873, 1185
AsuHPI GGTGA 6 cut(s) 8, 21, 198, 240, 451, 1056
AsuII TTCGAA 1 cut(s) 746
AvaII GGWCC 2 cut(s) 873, 1185
AvrII CCTAGG 1 cut(s) 609
BaeGI GKGCMC 1 cut(s) 135
BalI TGGCCA 1 cut(s) 924
BanII GRGCYC 1 cut(s) 246
BauI CACGAG 1 cut(s) 940
BbsI GAAGAC 1 cut(s) 1054
Bbv12I GWGCWC 1 cut(s) 135
BbvI GCAGC 5 cut(s) 402, 405, 428, 431, 599
BccI CCATC 2 cut(s) 111, 507
BceAI ACGGC 1 cut(s) 590
BciT130I CCWGG 2 cut(s) 352, 1200
BclI TGATCA 2 cut(s) 272, 1022
BcoDI GTCTC 3 cut(s) 102, 352, 599
BfaI CTAG 4 cut(s) 373, 397, 610, 673
BfmI CTRYAG 2 cut(s) 176, 989
BfoI RGCGCY 1 cut(s) 580
BisI GCNGC 5 cut(s) 391, 394, 417, 420, 588
BlnI CCTAGG 1 cut(s) 609
BlsI GCNGC 5 cut(s) 392, 395, 418, 421, 589
Bme1390I CCNGG 2 cut(s) 352, 1200
Bme18I GGWCC 2 cut(s) 873, 1185
BmgT120I GGNCC 2 cut(s) 873, 1185
BmiI GGNNCC 2 cut(s) 139, 875
BmrFI CCNGG 2 cut(s) 352, 1200
BmsI GCATC 7 cut(s) 71, 146, 161, 320, 677, 688, 778
BpiI GAAGAC 1 cut(s) 1054
Bpu14I TTCGAA 1 cut(s) 746
BsaI GGTCTC 2 cut(s) 102, 599
BsaJI CCNNGG 3 cut(s) 351, 572, 609
BsaWI WCCGGW 1 cut(s) 626
Bsc4I CCNNNNNNNGG 1 cut(s) 147
Bse1I ACTGG 2 cut(s) 211, 1187
Bse3DI GCAATG 1 cut(s) 766
BseBI CCWGG 2 cut(s) 352, 1200
BseDI CCNNGG 3 cut(s) 351, 572, 609
BseGI GGATG 5 cut(s) 86, 518, 668, 679, 738
BseLI CCNNNNNNNGG 1 cut(s) 147
BseMI GCAATG 1 cut(s) 766
BseMII CTCAG 2 cut(s) 67, 550
BseNI ACTGG 2 cut(s) 211, 1187
BseRI GAGGAG 1 cut(s) 312
BseSI GKGCMC 1 cut(s) 135
BseXI GCAGC 5 cut(s) 402, 405, 428, 431, 599
BseYI CCCAGC 1 cut(s) 1122
BsgI GTGCAG 1 cut(s) 694
Bsh1236I CGCG 1 cut(s) 525
BshFI GGCC 2 cut(s) 453, 924
BsiHKAI GWGCWC 1 cut(s) 135
BsiSI CCGG 1 cut(s) 627
BslFI GGGAC 1 cut(s) 999
BslI CCNNNNNNNGG 1 cut(s) 147
BsmAI GTCTC 3 cut(s) 102, 352, 599
BsmFI GGGAC 1 cut(s) 999
BsmI GAATGC 1 cut(s) 771
BsnI GGCC 2 cut(s) 453, 924
Bso31I GGTCTC 2 cut(s) 102, 599
Bsp119I TTCGAA 1 cut(s) 746
Bsp1286I GDGCHC 2 cut(s) 135, 246
Bsp1407I TGTACA 3 cut(s) 162, 384, 735
Bsp143I GATC 4 cut(s) 150, 272, 598, 1022
BspANI GGCC 2 cut(s) 453, 924
BspCNI CTCAG 2 cut(s) 68, 551
BspFNI CGCG 1 cut(s) 525
BspHI TCATGA 1 cut(s) 1009
BspLI GGNNCC 2 cut(s) 139, 875
BspPI GGATC 1 cut(s) 158
BspT104I TTCGAA 1 cut(s) 746
BspTNI GGTCTC 2 cut(s) 102, 599
BsrDI GCAATG 1 cut(s) 766
BsrGI TGTACA 3 cut(s) 162, 384, 735
BsrI ACTGG 2 cut(s) 211, 1187
BssECI CCNNGG 3 cut(s) 351, 572, 609
BssMI GATC 4 cut(s) 150, 272, 598, 1022
BssSI CACGAG 1 cut(s) 940
BssT1I CCWWGG 1 cut(s) 609
Bst2BI CACGAG 1 cut(s) 940
Bst2UI CCWGG 2 cut(s) 352, 1200
Bst4CI ACNGT 4 cut(s) 105, 762, 990, 1079
Bst6I CTCTTC 1 cut(s) 289
BstAUI TGTACA 3 cut(s) 162, 384, 735
BstBI TTCGAA 1 cut(s) 746
BstC8I GCNNGC 1 cut(s) 527
BstDEI CTNAG 2 cut(s) 76, 559
BstDSI CCRYGG 1 cut(s) 572
BstF5I GGATG 5 cut(s) 86, 518, 668, 679, 738
BstFNI CGCG 1 cut(s) 525
BstH2I RGCGCY 1 cut(s) 580
BstHHI GCGC 2 cut(s) 525, 579
BstKTI GATC 4 cut(s) 153, 275, 601, 1025
BstMAI GTCTC 3 cut(s) 102, 352, 599
BstMBI GATC 4 cut(s) 150, 272, 598, 1022
BstMWI GCNNNNNNNGC 2 cut(s) 250, 1119
BstNI CCWGG 2 cut(s) 352, 1200
BstNSI RCATGY 2 cut(s) 163, 325
BstSCI CCNGG 2 cut(s) 350, 1198
BstSFI CTRYAG 2 cut(s) 176, 989
BstSLI GKGCMC 1 cut(s) 135
BstUI CGCG 1 cut(s) 525
BstV1I GCAGC 5 cut(s) 402, 405, 428, 431, 599
BstV2I GAAGAC 1 cut(s) 1054
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
BsuRI GGCC 2 cut(s) 453, 924
BtgI CCRYGG 1 cut(s) 572
BtsCI GGATG 5 cut(s) 86, 518, 668, 679, 738
BtsIMutI CAGTG 5 cut(s) 110, 135, 218, 767, 891
Cac8I GCNNGC 1 cut(s) 527
CciI TCATGA 1 cut(s) 1009
CfoI GCGC 2 cut(s) 525, 579
Cfr13I GGNCC 2 cut(s) 873, 1185
Csp6I GTAC 6 cut(s) 163, 385, 407, 565, 727, 736
CviAII CATG 8 cut(s) 160, 284, 322, 364, 792, 839, 1010, 1140
CviQI GTAC 6 cut(s) 163, 385, 407, 565, 727, 736
DdeI CTNAG 2 cut(s) 76, 559
DpnI GATC 4 cut(s) 152, 274, 600, 1024
DpnII GATC 4 cut(s) 150, 272, 598, 1022
EaeI YGGCCR 1 cut(s) 922
Eam1104I CTCTTC 1 cut(s) 289
EarI CTCTTC 1 cut(s) 289
Eco130I CCWWGG 1 cut(s) 609
Eco24I GRGCYC 1 cut(s) 246
Eco31I GGTCTC 2 cut(s) 102, 599
Eco32I GATATC 1 cut(s) 1168
Eco47I GGWCC 2 cut(s) 873, 1185
Eco57I CTGAAG 1 cut(s) 40
EcoRII CCWGG 2 cut(s) 350, 1198
EcoRV GATATC 1 cut(s) 1168
EcoT14I CCWWGG 1 cut(s) 609
EcoT22I ATGCAT 3 cut(s) 86, 161, 793
EcoT38I GRGCYC 1 cut(s) 246
ErhI CCWWGG 1 cut(s) 609
FaeI CATG 8 cut(s) 163, 287, 325, 367, 795, 842, 1013, 1143
FaqI GGGAC 1 cut(s) 999
FatI CATG 8 cut(s) 159, 283, 321, 363, 791, 838, 1009, 1139
FbaI TGATCA 2 cut(s) 272, 1022
Fnu4HI GCNGC 5 cut(s) 391, 394, 417, 420, 588
FokI GGATG 5 cut(s) 93, 525, 655, 666, 725
FriOI GRGCYC 1 cut(s) 246
Fsp4HI GCNGC 5 cut(s) 391, 394, 417, 420, 588
FspBI CTAG 4 cut(s) 373, 397, 610, 673
GlaI GCGC 2 cut(s) 524, 578
GluI GCNGC 5 cut(s) 391, 394, 417, 420, 588
GsaI CCCAGC 1 cut(s) 1126
HaeII RGCGCY 1 cut(s) 580
HaeIII GGCC 2 cut(s) 453, 924
HapII CCGG 1 cut(s) 627
HhaI GCGC 2 cut(s) 525, 579
Hin1II CATG 8 cut(s) 163, 287, 325, 367, 795, 842, 1013, 1143
Hin6I GCGC 2 cut(s) 523, 577
HinP1I GCGC 2 cut(s) 523, 577
HindIII AAGCTT 2 cut(s) 341, 688
HinfI GANTC 4 cut(s) 2, 641, 1032, 1041
HpaII CCGG 1 cut(s) 627
HphI GGTGA 6 cut(s) 8, 21, 198, 240, 451, 1056
Hpy166II GTNNAC 5 cut(s) 29, 133, 385, 736, 1085
Hpy188III TCNNGA 5 cut(s) 204, 602, 971, 1010, 1145
Hpy8I GTNNAC 5 cut(s) 29, 133, 385, 736, 1085
HpyAV CCTTC 3 cut(s) 205, 836, 1198
HpyCH4III ACNGT 4 cut(s) 105, 762, 990, 1079
HpyCH4IV ACGT 3 cut(s) 277, 719, 1051
HpyF10VI GCNNNNNNNGC 2 cut(s) 250, 1119
HpyF3I CTNAG 2 cut(s) 76, 559
HpySE526I ACGT 3 cut(s) 277, 719, 1051
Hsp92II CATG 8 cut(s) 163, 287, 325, 367, 795, 842, 1013, 1143
HspAI GCGC 2 cut(s) 523, 577
Ksp22I TGATCA 2 cut(s) 272, 1022
Kzo9I GATC 4 cut(s) 150, 272, 598, 1022
Lsp1109I GCAGC 5 cut(s) 402, 405, 428, 431, 599
LweI GCATC 7 cut(s) 71, 146, 161, 320, 677, 688, 778
MaeI CTAG 4 cut(s) 373, 397, 610, 673
MaeII ACGT 3 cut(s) 277, 719, 1051
MaeIII GTNAC 4 cut(s) 234, 505, 935, 1178
MalI GATC 4 cut(s) 152, 274, 600, 1024
MboI GATC 4 cut(s) 150, 272, 598, 1022
MboII GAAGA 9 cut(s) 46, 306, 668, 694, 867, 1059, 1109, 1112, 1165
MfeI CAATTG 2 cut(s) 312, 499
MflI RGATCY 1 cut(s) 150
MhlI GDGCHC 2 cut(s) 135, 246
MlsI TGGCCA 1 cut(s) 924
MluCI AATT 8 cut(s) 20, 142, 312, 477, 499, 828, 847, 1203
MluNI TGGCCA 1 cut(s) 924
MmeI TCCRAC 1 cut(s) 1034
Mox20I TGGCCA 1 cut(s) 924
Mph1103I ATGCAT 3 cut(s) 86, 161, 793
MroXI GAANNNNTTC 1 cut(s) 752
MscI TGGCCA 1 cut(s) 924
MseI TTAA 4 cut(s) 100, 145, 411, 1213
MslI CAYNNNNRTG 2 cut(s) 89, 1014
Msp20I TGGCCA 1 cut(s) 924
MspI CCGG 1 cut(s) 627
MspR9I CCNGG 2 cut(s) 352, 1200
MunI CAATTG 2 cut(s) 312, 499
Mva1269I GAATGC 1 cut(s) 771
MvaI CCWGG 2 cut(s) 352, 1200
MvnI CGCG 1 cut(s) 525
MwoI GCNNNNNNNGC 2 cut(s) 250, 1119
NdeII GATC 4 cut(s) 150, 272, 598, 1022
NlaIII CATG 8 cut(s) 163, 287, 325, 367, 795, 842, 1013, 1143
NlaIV GGNNCC 2 cut(s) 139, 875
NmuCI GTSAC 1 cut(s) 234
NsiI ATGCAT 3 cut(s) 86, 161, 793
NspI RCATGY 2 cut(s) 163, 325
NspV TTCGAA 1 cut(s) 746
PagI TCATGA 1 cut(s) 1009
PctI GAATGC 1 cut(s) 771
PdmI GAANNNNTTC 1 cut(s) 752
PfeI GAWTC 4 cut(s) 2, 641, 1032, 1041
PkrI GCNGC 5 cut(s) 392, 395, 418, 421, 589
Psp6I CCWGG 2 cut(s) 350, 1198
PspFI CCCAGC 1 cut(s) 1122
PspGI CCWGG 2 cut(s) 350, 1198
PspN4I GGNNCC 2 cut(s) 139, 875
PspPI GGNCC 2 cut(s) 873, 1185
PsuI RGATCY 1 cut(s) 150
RsaI GTAC 6 cut(s) 164, 386, 408, 566, 728, 737
RsaNI GTAC 6 cut(s) 163, 385, 407, 565, 727, 736
RseI CAYNNNNRTG 2 cut(s) 89, 1014
SaqAI TTAA 4 cut(s) 100, 145, 411, 1213
SatI GCNGC 5 cut(s) 391, 394, 417, 420, 588
Sau3AI GATC 4 cut(s) 150, 272, 598, 1022
Sau96I GGNCC 2 cut(s) 873, 1185
ScrFI CCNGG 2 cut(s) 352, 1200
SduI GDGCHC 2 cut(s) 135, 246
SfaNI GCATC 7 cut(s) 71, 146, 161, 320, 677, 688, 778
SfcI CTRYAG 2 cut(s) 176, 989
SfuI TTCGAA 1 cut(s) 746
SinI GGWCC 2 cut(s) 873, 1185
SmiMI CAYNNNNRTG 2 cut(s) 89, 1014
Sse9I AATT 8 cut(s) 20, 142, 312, 477, 499, 828, 847, 1203
SspMI CTAG 4 cut(s) 373, 397, 610, 673
StyD4I CCNGG 2 cut(s) 350, 1198
StyI CCWWGG 1 cut(s) 609
TaaI ACNGT 4 cut(s) 105, 762, 990, 1079
TaiI ACGT 3 cut(s) 280, 722, 1054
TaqI TCGA 2 cut(s) 746, 972
TasI AATT 8 cut(s) 20, 142, 312, 477, 499, 828, 847, 1203
TatI WGTACW 5 cut(s) 162, 384, 564, 726, 735
TfiI GAWTC 4 cut(s) 2, 641, 1032, 1041
Tru1I TTAA 4 cut(s) 100, 145, 411, 1213
Tru9I TTAA 4 cut(s) 100, 145, 411, 1213
TscAI CASTG 5 cut(s) 110, 135, 218, 767, 898
TseFI GTSAC 1 cut(s) 234
TseI GCWGC 5 cut(s) 390, 393, 416, 419, 587
Tsp45I GTSAC 1 cut(s) 234
TspDTI ATGAA 5 cut(s) 352, 507, 841, 855, 1132
TspGWI ACGGA 1 cut(s) 150
TspRI CASTG 5 cut(s) 110, 135, 218, 767, 898
VneI GTGCAC 1 cut(s) 131
VpaK11BI GGWCC 2 cut(s) 873, 1185
XceI RCATGY 2 cut(s) 163, 325
XmaJI CCTAGG 1 cut(s) 609
XmnI GAANNNNTTC 1 cut(s) 752
XspI CTAG 4 cut(s) 373, 397, 610, 673
Zsp2I ATGCAT 3 cut(s) 86, 161, 793
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.