Rmu_co8233329.1_g000001

Belongs to the PI3 PI4-kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8233329.1
Physical Location & Seq
Reverse (-)
1 .. 737
737 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8233329.1_g000001.1.cds

Sequence Viewer

Length: 465 bp
ctggaatcttcagggccttcatattgttggaccgagctgattactctgagtactaagtataatgacttgactggtcactcacagcttgcttttactgtttgggatgtttcgtgtgggaacgatgaagggttgattggtggtgctacgattcttctctttaataacaagaagcaactcaagacggggaagcaaaagctgaggctttggaaaggaaaagtagctgatgggtcatttcctacttcgactcctggaaaggttccccggaatgaacgtggggagttggaacgtttggagaagctagtgaataagtatgagaggggacagatccaatgtgttgattggctggaccgccttgcatttaaagctatggagagaataaaggaacgtgaaagctctaaaaatggaagtttgcatttgtacctggttgtcgatttctctagttttgagcatcgtgttgttttccag
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

155

Amino Acids

17.65

Weight (kDa)

8.98

Isoelectric Point (pI)

20.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 349
AclI AACGTT 1 cut(s) 286
AclWI GGATC 1 cut(s) 319
AfaI GTAC 2 cut(s) 52, 419
AjnI CCWGG 2 cut(s) 247, 420
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 7 cut(s) 37, 85, 196, 221, 298, 365, 393
AluI AGCT 7 cut(s) 37, 85, 196, 221, 298, 365, 393
AlwI GGATC 1 cut(s) 319
AoxI GGCC 1 cut(s) 14
AspS9I GGNCC 3 cut(s) 14, 30, 346
AsuC2I CCSGG 1 cut(s) 262
AvaII GGWCC 2 cut(s) 30, 346
BbvCI CCTCAGC 1 cut(s) 197
BccI CCATC 1 cut(s) 218
BciT130I CCWGG 2 cut(s) 249, 422
BcnI CCSGG 1 cut(s) 262
BfaI CTAG 2 cut(s) 299, 438
BmcAI AGTACT 1 cut(s) 52
Bme1390I CCNGG 3 cut(s) 249, 262, 422
Bme18I GGWCC 2 cut(s) 30, 346
BmgT120I GGNCC 3 cut(s) 14, 30, 346
BmiI GGNNCC 1 cut(s) 258
BmrFI CCNGG 3 cut(s) 249, 262, 422
BmsI GCATC 1 cut(s) 457
Bpu10I CCTNAGC 1 cut(s) 197
BpuEI CTTGAG 1 cut(s) 161
BpuMI CCSGG 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 260
BsaXI ACNNNNNCTCC 2 cut(s) 229, 259
Bse1I ACTGG 1 cut(s) 76
BseBI CCWGG 2 cut(s) 249, 422
BseDI CCNNGG 1 cut(s) 260
BseGI GGATG 1 cut(s) 109
BseMII CTCAG 2 cut(s) 38, 188
BseNI ACTGG 1 cut(s) 76
BshFI GGCC 1 cut(s) 16
BsiSI CCGG 1 cut(s) 262
BslFI GGGAC 1 cut(s) 333
BsmFI GGGAC 1 cut(s) 333
BsnI GGCC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 324
BspACI CCGC 1 cut(s) 349
BspANI GGCC 1 cut(s) 16
BspCNI CTCAG 2 cut(s) 39, 189
BspLI GGNNCC 1 cut(s) 258
BspPI GGATC 1 cut(s) 319
BsrI ACTGG 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 1 cut(s) 324
Bst2UI CCWGG 2 cut(s) 249, 422
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 3 cut(s) 47, 54, 197
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 1 cut(s) 327
BstMBI GATC 1 cut(s) 324
BstMWI GCNNNNNNNGC 1 cut(s) 362
BstNI CCWGG 2 cut(s) 249, 422
BstSCI CCNGG 3 cut(s) 247, 260, 420
BstX2I RGATCY 1 cut(s) 324
BstYI RGATCY 1 cut(s) 324
BsuRI GGCC 1 cut(s) 16
BtsCI GGATG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 87
Cfr13I GGNCC 3 cut(s) 14, 30, 346
CsiI ACCWGGT 1 cut(s) 420
Csp6I GTAC 2 cut(s) 51, 418
CviQI GTAC 2 cut(s) 51, 418
DdeI CTNAG 3 cut(s) 47, 54, 197
DpnI GATC 1 cut(s) 326
DpnII GATC 1 cut(s) 324
DraI TTTAAA 1 cut(s) 361
Eco47I GGWCC 2 cut(s) 30, 346
EcoO109I RGGNCCY 1 cut(s) 14
EcoRII CCWGG 2 cut(s) 247, 420
FaiI YATR 4 cut(s) 22, 60, 312, 368
FaqI GGGAC 1 cut(s) 333
FokI GGATG 1 cut(s) 116
FspBI CTAG 2 cut(s) 299, 438
HaeIII GGCC 1 cut(s) 16
HapII CCGG 1 cut(s) 262
HinfI GANTC 3 cut(s) 5, 148, 244
HpaII CCGG 1 cut(s) 262
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 178
HpyAV CCTTC 2 cut(s) 27, 119
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4IV ACGT 3 cut(s) 271, 286, 385
HpyCH4V TGCA 2 cut(s) 356, 412
HpyF10VI GCNNNNNNNGC 1 cut(s) 362
HpyF3I CTNAG 3 cut(s) 47, 54, 197
HpySE526I ACGT 3 cut(s) 271, 286, 385
Kzo9I GATC 1 cut(s) 324
LpnPI CCDG 7 cut(s) 57, 234, 261, 275, 329, 407, 434
LweI GCATC 1 cut(s) 457
MabI ACCWGGT 1 cut(s) 420
MaeI CTAG 2 cut(s) 299, 438
MaeII ACGT 3 cut(s) 271, 286, 385
MaeIII GTNAC 1 cut(s) 74
MalI GATC 1 cut(s) 326
MboI GATC 1 cut(s) 324
MboII GAAGA 1 cut(s) 143
MflI RGATCY 1 cut(s) 324
MlyI GAGTC 1 cut(s) 238
MmeI TCCRAC 2 cut(s) 8, 261
MnlI CCTC 2 cut(s) 192, 309
MseI TTAA 2 cut(s) 159, 360
MspI CCGG 1 cut(s) 262
MspR9I CCNGG 3 cut(s) 249, 262, 422
MvaI CCWGG 2 cut(s) 249, 422
MwoI GCNNNNNNNGC 1 cut(s) 362
NciI CCSGG 1 cut(s) 262
NdeII GATC 1 cut(s) 324
NlaIV GGNNCC 1 cut(s) 258
NmuCI GTSAC 1 cut(s) 74
PfeI GAWTC 2 cut(s) 5, 148
PfoI TCCNGGA 1 cut(s) 247
PleI GAGTC 1 cut(s) 238
PpsI GAGTC 1 cut(s) 238
Psp1406I AACGTT 1 cut(s) 286
Psp6I CCWGG 2 cut(s) 247, 420
PspGI CCWGG 2 cut(s) 247, 420
PspN4I GGNNCC 1 cut(s) 258
PspPI GGNCC 3 cut(s) 14, 30, 346
PsuI RGATCY 1 cut(s) 324
RsaI GTAC 2 cut(s) 52, 419
RsaNI GTAC 2 cut(s) 51, 418
SaqAI TTAA 2 cut(s) 159, 360
Sau3AI GATC 1 cut(s) 324
Sau96I GGNCC 3 cut(s) 14, 30, 346
ScaI AGTACT 1 cut(s) 52
SchI GAGTC 1 cut(s) 238
ScrFI CCNGG 3 cut(s) 249, 262, 422
SexAI ACCWGGT 1 cut(s) 420
SfaNI GCATC 1 cut(s) 457
SinI GGWCC 2 cut(s) 30, 346
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
SsiI CCGC 1 cut(s) 349
SspMI CTAG 2 cut(s) 299, 438
StyD4I CCNGG 3 cut(s) 247, 260, 420
TaaI ACNGT 1 cut(s) 97
TaiI ACGT 3 cut(s) 274, 289, 388
TaqI TCGA 2 cut(s) 242, 429
TaqII GACCGA 1 cut(s) 47
TatI WGTACW 1 cut(s) 50
TfiI GAWTC 2 cut(s) 5, 148
Tru1I TTAA 2 cut(s) 159, 360
Tru9I TTAA 2 cut(s) 159, 360
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 3 cut(s) 9, 138, 282
VpaK11BI GGWCC 2 cut(s) 30, 346
XspI CTAG 2 cut(s) 299, 438
ZrmI AGTACT 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.