Rmu_co8289587.1_g000001
ERF Family

Pectate lyase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8289587.1
OG0013425
Physical Location & Seq
Reverse (-)
1 .. 738
738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8289587.1_g000001.1.cds

Sequence Viewer

Length: 509 bp
ctggtgtttgacaatatcactattgtagattctcatagagggctgggattccagatacgtgatggaggaaatgtgagtgatgttatcttttcaaacattaatatcagcacaagatactatcatcaatcctggtggggaagagcagaacctatttatgtgactacttgtccacgcgactcatatgcaaaggagggttcaatctctaacctactctttgtgaacatcagtgcaaattcagagaatggtatatttttatcaggctctaaaaaggggcttcttagtgatttgagattcatcaacttgaatctgacctacagcagacggaccaacaatgtgggtgggttggtagactacagaccaggatgccaagggctggtaaagcacagcacagctggattcatcatggagtacattaatggcttagtgtttgacaatatttacatgagatggtccgatgagcaatggtctgctgagcaattaggacagtggaataatcccttggatttcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_28 Pectate_lyase_3

Protein Analysis

169

Amino Acids

19.17

Weight (kDa)

5.88

Isoelectric Point (pI)

40.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013425)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G57790 AT3G57790
fragaria_vesca FvH4_6g22970
malus_domestica MD03G1162500.v1.1 MD12G1064100.v1.1
prunus_persica Prupe.7G070000_v2.0.a1
pyrus_communis pycom12g05590
rosa_chinensis RchiOBHm_Chr3g0480761
rosa_laevigata RLG00000023454
rosa_multiflora Rmu_co8289587.1_g000001 Rmu_sc0003902.1_g000012
rosa_roxburghii Rroxscaffold_6G00401090
rosa_rugosa Rorug03G0185600
rosa_samantha Rh3AG237700 Rh3BG271100 Rh3CG267200 Rh3DG263200
rosa_wichuraiana Rw3G021290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 373
AccI GTMKAC 1 cut(s) 348
AccII CGCG 1 cut(s) 174
AcsI RAATTY 1 cut(s) 232
AfaI GTAC 1 cut(s) 410
AfiI CCNNNNNNNGG 1 cut(s) 373
AgsI TTSAA 3 cut(s) 93, 198, 304
AhdI GACNNNNNGTC 1 cut(s) 165
AjnI CCWGG 2 cut(s) 128, 358
AjuI GAANNNNNNNTTGG 1 cut(s) 482
AluBI AGCT 1 cut(s) 392
AluI AGCT 1 cut(s) 392
ApoI RAATTY 1 cut(s) 232
AseI ATTAAT 2 cut(s) 99, 414
AspS9I GGNCC 2 cut(s) 324, 450
AvaII GGWCC 2 cut(s) 324, 450
BccI CCATC 2 cut(s) 56, 441
BcgI CGANNNNNNTGC 2 cut(s) 164, 198
BciT130I CCWGG 2 cut(s) 130, 360
BfmI CTRYAG 2 cut(s) 313, 352
BlpI GCTNAGC 1 cut(s) 471
Bme1390I CCNGG 2 cut(s) 130, 360
Bme18I GGWCC 2 cut(s) 324, 450
BmeRI GACNNNNNGTC 1 cut(s) 165
BmgT120I GGNCC 2 cut(s) 324, 450
BmrFI CCNGG 2 cut(s) 130, 360
BmsI GCATC 1 cut(s) 353
Bpu1102I GCTNAGC 1 cut(s) 471
BsaAI YACGTR 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 367, 498
BsaXI ACNNNNNCTCC 2 cut(s) 57, 87
Bsc4I CCNNNNNNNGG 1 cut(s) 373
Bse3DI GCAATG 1 cut(s) 467
BseBI CCWGG 2 cut(s) 130, 360
BseDI CCNNGG 2 cut(s) 367, 498
BseGI GGATG 1 cut(s) 368
BseLI CCNNNNNNNGG 1 cut(s) 373
BseMI GCAATG 1 cut(s) 467
BseMII CTCAG 1 cut(s) 462
BseYI CCCAGC 1 cut(s) 43
Bsh1236I CGCG 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 373
Bsp1720I GCTNAGC 1 cut(s) 471
BspCNI CTCAG 1 cut(s) 463
BspFNI CGCG 1 cut(s) 174
BspQI GCTCTTC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 467
BssECI CCNNGG 2 cut(s) 367, 498
BssT1I CCWWGG 2 cut(s) 367, 498
Bst2UI CCWGG 2 cut(s) 130, 360
Bst4CI ACNGT 1 cut(s) 486
Bst6I CTCTTC 1 cut(s) 133
BstBAI YACGTR 1 cut(s) 59
BstDEI CTNAG 3 cut(s) 278, 421, 471
BstF5I GGATG 1 cut(s) 368
BstFNI CGCG 1 cut(s) 174
BstMWI GCNNNNNNNGC 1 cut(s) 379
BstNI CCWGG 2 cut(s) 130, 360
BstSCI CCNGG 2 cut(s) 128, 358
BstSFI CTRYAG 2 cut(s) 313, 352
BstUI CGCG 1 cut(s) 174
BstXI CCANNNNNNTGG 1 cut(s) 334
BtsCI GGATG 1 cut(s) 368
BtsIMutI CAGTG 2 cut(s) 232, 491
Cfr13I GGNCC 2 cut(s) 324, 450
Csp6I GTAC 1 cut(s) 409
CspCI CAANNNNNGTGG 4 cut(s) 113, 148, 319, 354
CviAII CATG 2 cut(s) 403, 442
CviJI RGCY 6 cut(s) 43, 261, 274, 373, 392, 420
CviKI_1 RGCY 6 cut(s) 43, 261, 274, 373, 392, 420
CviQI GTAC 1 cut(s) 409
DdeI CTNAG 3 cut(s) 278, 421, 471
DriI GACNNNNNGTC 1 cut(s) 165
Eam1104I CTCTTC 1 cut(s) 133
Eam1105I GACNNNNNGTC 1 cut(s) 165
EarI CTCTTC 1 cut(s) 133
Eco130I CCWWGG 2 cut(s) 367, 498
Eco47I GGWCC 2 cut(s) 324, 450
EcoRII CCWGG 2 cut(s) 128, 358
EcoT14I CCWWGG 2 cut(s) 367, 498
ErhI CCWWGG 2 cut(s) 367, 498
FaeI CATG 2 cut(s) 406, 445
FaiI YATR 7 cut(s) 36, 156, 181, 183, 248, 404, 443
FatI CATG 2 cut(s) 402, 441
FauNDI CATATG 1 cut(s) 181
FblI GTMKAC 1 cut(s) 348
FokI GGATG 1 cut(s) 375
GsaI CCCAGC 1 cut(s) 47
Hin1II CATG 2 cut(s) 406, 445
HinfI GANTC 6 cut(s) 29, 48, 176, 291, 304, 396
Hpy166II GTNNAC 3 cut(s) 170, 220, 349
Hpy188I TCNGA 3 cut(s) 238, 309, 454
Hpy188III TCNNGA 1 cut(s) 52
Hpy8I GTNNAC 3 cut(s) 170, 220, 349
HpyCH4III ACNGT 1 cut(s) 486
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 185, 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 379
HpyF3I CTNAG 3 cut(s) 278, 421, 471
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 2 cut(s) 406, 445
LguI GCTCTTC 1 cut(s) 133
LpnPI CCDG 9 cut(s) 29, 65, 115, 142, 243, 345, 359, 372, 378
LweI GCATC 1 cut(s) 353
MaeII ACGT 1 cut(s) 58
MaeIII GTNAC 1 cut(s) 157
MboII GAAGA 1 cut(s) 150
MluCI AATT 2 cut(s) 232, 476
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 3 cut(s) 32, 59, 184
MseI TTAA 2 cut(s) 99, 414
MspA1I CMGCKG 1 cut(s) 392
MspR9I CCNGG 2 cut(s) 130, 360
MvaI CCWGG 2 cut(s) 130, 360
MvnI CGCG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 379
NdeI CATATG 1 cut(s) 181
NlaIII CATG 2 cut(s) 406, 445
NmuCI GTSAC 1 cut(s) 157
PciSI GCTCTTC 1 cut(s) 133
PfeI GAWTC 5 cut(s) 29, 48, 291, 304, 396
PflMI CCANNNNNTGG 1 cut(s) 373
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
Ppu21I YACGTR 1 cut(s) 59
PshBI ATTAAT 2 cut(s) 99, 414
Psp6I CCWGG 2 cut(s) 128, 358
PspFI CCCAGC 1 cut(s) 43
PspGI CCWGG 2 cut(s) 128, 358
PspPI GGNCC 2 cut(s) 324, 450
PvuII CAGCTG 1 cut(s) 392
RsaI GTAC 1 cut(s) 410
RsaNI GTAC 1 cut(s) 409
SapI GCTCTTC 1 cut(s) 133
SaqAI TTAA 2 cut(s) 99, 414
Sau96I GGNCC 2 cut(s) 324, 450
SchI GAGTC 1 cut(s) 170
ScrFI CCNGG 2 cut(s) 130, 360
SetI ASST 5 cut(s) 61, 151, 210, 314, 394
SfaNI GCATC 1 cut(s) 353
SfcI CTRYAG 2 cut(s) 313, 352
SinI GGWCC 2 cut(s) 324, 450
Sse9I AATT 2 cut(s) 232, 476
SspI AATATT 1 cut(s) 436
StyD4I CCNGG 2 cut(s) 128, 358
StyI CCWWGG 2 cut(s) 367, 498
TaaI ACNGT 1 cut(s) 486
TaiI ACGT 1 cut(s) 61
TasI AATT 2 cut(s) 232, 476
TatI WGTACW 1 cut(s) 408
TfiI GAWTC 5 cut(s) 29, 48, 291, 304, 396
Tru1I TTAA 2 cut(s) 99, 414
Tru9I TTAA 2 cut(s) 99, 414
TscAI CASTG 2 cut(s) 232, 491
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 283, 388
TspGWI ACGGA 1 cut(s) 337
TspRI CASTG 2 cut(s) 232, 491
Van91I CCANNNNNTGG 1 cut(s) 373
VpaK11BI GGWCC 2 cut(s) 324, 450
VspI ATTAAT 2 cut(s) 99, 414
XapI RAATTY 1 cut(s) 232
XcmI CCANNNNNNNNNTGG 1 cut(s) 59
XmiI GTMKAC 1 cut(s) 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.