Rmu_co8338671.1_g000001

Glucan endo-13-beta-glucosidase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8338671.1
Physical Location & Seq
Forward (+)
231 .. 672
442 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8338671.1_g000001.1.cds

Sequence Viewer

Length: 348 bp
atgccatcaagatttctatggcttctgctagctctgctgtgtttagccctaacaccacgaagatctggtggacagttagaggaatggtgcatagctgataagcagaccccggcggacgagctaaagatggcacttgattgggcttgtgagaagggaggtgcagactgcagtaagatacaagagaaccaagcttgctacttgcctaatactctggagcaccatgcctcttatgctttcaacaattactatcaaaagttcaagcaggaaggtgcaacatgttacttcaatgctgctgcatttgtcactgcccttgatccaagtaatataattctgaagatacactactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

13.02

Weight (kDa)

5.85

Isoelectric Point (pI)

57.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 113
AclWI GGATC 1 cut(s) 308
AflIII ACRYGT 1 cut(s) 275
AgsI TTSAA 3 cut(s) 238, 259, 286
AluBI AGCT 4 cut(s) 32, 95, 121, 191
AluI AGCT 4 cut(s) 32, 95, 121, 191
Alw21I GWGCWC 1 cut(s) 219
AlwI GGATC 1 cut(s) 308
ApeKI GCWGC 2 cut(s) 290, 293
AsuC2I CCSGG 1 cut(s) 110
AsuNHI GCTAGC 1 cut(s) 28
BarI GAAGNNNNNNTAC 1 cut(s) 326
Bbv12I GWGCWC 1 cut(s) 219
BbvI GCAGC 2 cut(s) 277, 280
BccI CCATC 2 cut(s) 13, 121
BcnI CCSGG 1 cut(s) 110
BfaI CTAG 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 166
BglII AGATCT 1 cut(s) 62
BisI GCNGC 2 cut(s) 291, 294
BlsI GCNGC 2 cut(s) 292, 295
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BmtI GCTAGC 1 cut(s) 32
BpmI CTGGAG 1 cut(s) 233
BpuMI CCSGG 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 108
BseXI GCAGC 2 cut(s) 277, 280
BsgI GTGCAG 1 cut(s) 180
BsiHKAI GWGCWC 1 cut(s) 219
BsiSI CCGG 1 cut(s) 110
Bsp1286I GDGCHC 1 cut(s) 219
Bsp143I GATC 2 cut(s) 62, 313
BspACI CCGC 1 cut(s) 113
BspMAI CTGCAG 1 cut(s) 170
BspOI GCTAGC 1 cut(s) 32
BspPI GGATC 1 cut(s) 308
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 2 cut(s) 62, 313
Bst4CI ACNGT 1 cut(s) 75
BstC8I GCNNGC 2 cut(s) 30, 193
BstKTI GATC 2 cut(s) 65, 316
BstMBI GATC 2 cut(s) 62, 313
BstMWI GCNNNNNNNGC 2 cut(s) 34, 230
BstNSI RCATGY 1 cut(s) 279
BstSCI CCNGG 1 cut(s) 108
BstSFI CTRYAG 1 cut(s) 166
BstV1I GCAGC 2 cut(s) 277, 280
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BtsI GCAGTG 1 cut(s) 303
BtsIMutI CAGTG 1 cut(s) 303
Cac8I GCNNGC 2 cut(s) 30, 193
CviAII CATG 2 cut(s) 221, 276
CviJI RGCY 7 cut(s) 22, 32, 47, 95, 121, 143, 191
CviKI_1 RGCY 7 cut(s) 22, 32, 47, 95, 121, 143, 191
DpnI GATC 2 cut(s) 64, 315
DpnII GATC 2 cut(s) 62, 313
EciI GGCGGA 1 cut(s) 128
FaeI CATG 2 cut(s) 224, 279
FaiI YATR 6 cut(s) 19, 92, 222, 231, 277, 326
FatI CATG 2 cut(s) 220, 275
Fnu4HI GCNGC 2 cut(s) 291, 294
Fsp4HI GCNGC 2 cut(s) 291, 294
FspBI CTAG 1 cut(s) 29
GluI GCNGC 2 cut(s) 291, 294
GsuI CTGGAG 1 cut(s) 233
HapII CCGG 1 cut(s) 110
Hin1II CATG 2 cut(s) 224, 279
HindIII AAGCTT 1 cut(s) 189
HpaII CCGG 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 333
Hpy188III TCNNGA 2 cut(s) 9, 212
Hpy8I GTNNAC 1 cut(s) 71
HpyAV CCTTC 2 cut(s) 145, 260
HpyCH4III ACNGT 1 cut(s) 75
HpyCH4V TGCA 5 cut(s) 90, 161, 168, 272, 296
HpyF10VI GCNNNNNNNGC 2 cut(s) 34, 230
Hsp92II CATG 2 cut(s) 224, 279
Kzo9I GATC 2 cut(s) 62, 313
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 4 cut(s) 51, 123, 197, 248
Lsp1109I GCAGC 2 cut(s) 277, 280
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 2 cut(s) 278, 301
MalI GATC 2 cut(s) 64, 315
MboI GATC 2 cut(s) 62, 313
MboII GAAGA 2 cut(s) 72, 346
MflI RGATCY 1 cut(s) 62
MhlI GDGCHC 1 cut(s) 219
MluCI AATT 2 cut(s) 241, 327
MnlI CCTC 3 cut(s) 73, 149, 235
MspI CCGG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 110
MwoI GCNNNNNNNGC 2 cut(s) 34, 230
NciI CCSGG 1 cut(s) 110
NdeII GATC 2 cut(s) 62, 313
NheI GCTAGC 1 cut(s) 28
NlaIII CATG 2 cut(s) 224, 279
NmuCI GTSAC 1 cut(s) 301
NspI RCATGY 1 cut(s) 279
PciI ACATGT 1 cut(s) 275
PkrI GCNGC 2 cut(s) 292, 295
PscI ACATGT 1 cut(s) 275
PstI CTGCAG 1 cut(s) 170
PsuI RGATCY 1 cut(s) 62
SatI GCNGC 2 cut(s) 291, 294
Sau3AI GATC 2 cut(s) 62, 313
ScrFI CCNGG 1 cut(s) 110
SduI GDGCHC 1 cut(s) 219
SetI ASST 6 cut(s) 34, 97, 123, 160, 193, 271
SfcI CTRYAG 1 cut(s) 166
Sse9I AATT 2 cut(s) 241, 327
SsiI CCGC 1 cut(s) 113
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 108
TaaI ACNGT 1 cut(s) 75
TasI AATT 2 cut(s) 241, 327
TscAI CASTG 1 cut(s) 310
TseFI GTSAC 1 cut(s) 301
TseI GCWGC 2 cut(s) 290, 293
Tsp45I GTSAC 1 cut(s) 301
TspRI CASTG 1 cut(s) 310
XceI RCATGY 1 cut(s) 279
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.