Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8343931.1

Orthogroup ID

OG0006728

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1017

Gene Structure 1016 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8343931.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 981 bp

gaggaggtagttggctgtctgtaagtcagggaattgcagaagatacatctgatctggtatctggttttgctactgttggtgatggactgagtgaggattacccaaatgagtactgggattctgatgaatatgatgatgatgatgatgtgggatacatgagacaacctattgaagatgaggcctggttcttggctcatgaaattgattacccaagtgacaatgaaaaaggaacagggcatgggagtgttccagatccgcaggaaagaggcccaaccaaagatgaggatgatgatcaatcttttgctgaggaggattcttacttttctggtgagcgttactttcaagggaaaaatgttgaaccagttatagttacagatgatcctataggaatcacagtgactgagttgtatgggaggactgatgagaatgatttaatggctcaatatgatggacagttgatggatgaagaggaactgaatttgatgcgtgcagaacctgtctggcagggatttgtcactcagactaatgaactcatcatgttaggggatggcaaagttctgaatgagggtggaaggccacgtctagatgatgtttgcgtggaggatgatcagcatggttcagtgagatcaattggtgtggggatcaatagtgatgttgctgaaattggcagtgaagtacgggaaagtttggttggaggtagcagtgaaggggatttagaatacttccgagaccgtgatgaaggagtcggtgggtctcggaagcctcatcatgactcagaccaaaaacatattgatagatctaacagggacaacaagaaaagtagtaaacatgaggcaaataaatatatagttgttgccgatgataatagtgcatctagacccaagaaaaatcatacagaaggggcattttcattcccccctccactgagagatggaggacagtcagtgcaggcaagctccagtaaaactttatggtcaaaca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

326

Amino Acids

36.07

Weight (kDa)

4.23

Isoelectric Point (pI)

41.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006728)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G73450 AT1G73460 AT1G73460 AT3G17750
fragaria_vesca	FvH4_5g17930 FvH4_5g17930 FvH4_5g17930
malus_domestica	MD06G1234900.v1.1 MD14G1242100.v1.1
prunus_persica	Prupe.5G239700_v2.0.a1 Prupe.5G239700_v2.0.a1 Prupe.5G239700_v2.0.a1 Prupe.5G239700_v2.0.a1
pyrus_communis	pycom06g20990 pycom14g20350
rosa_chinensis	RchiOBHm_Chr7g0177671
rosa_laevigata	RLG00000005515
rosa_multiflora	Rmu_co8343931.1_g000001 Rmu_ssc0000236.1_g000003
rosa_roxburghii	Rroxscaffold_3G00275670
rosa_rugosa	Rorug06G0408400
rosa_samantha	Rh7AG007900 Rh7BG007800 Rh7CG008300 Rh7DG008000
rosa_wichuraiana	Rw7G000660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	256
AclWI	GGATC	3 cut(s)	247, 373, 649
AcsI	RAATTY	1 cut(s)	477
AfaI	GTAC	2 cut(s)	112, 677
AgsI	TTSAA	3 cut(s)	172, 343, 358
AjiI	CACGTC	1 cut(s)	580
AjnI	CCWGG	1 cut(s)	181
AjuI	GAANNNNNNNTTGG	2 cut(s)	674, 706
AluBI	AGCT	1 cut(s)	956
AluI	AGCT	1 cut(s)	956
Alw26I	GTCTC	3 cut(s)	153, 722, 758
AlwI	GGATC	3 cut(s)	247, 373, 649
AlwNI	CAGNNNCTG	2 cut(s)	400, 496
AoxI	GGCC	3 cut(s)	179, 267, 574
ApoI	RAATTY	1 cut(s)	477
AspS9I	GGNCC	1 cut(s)	268
AsuHPI	GGTGA	2 cut(s)	91, 340
BbvCI	CCTCAGC	1 cut(s)	305
BccI	CCATC	5 cut(s)	76, 442, 453, 541, 925
BciT130I	CCWGG	1 cut(s)	183
BciVI	GTATCC	1 cut(s)	145
BclI	TGATCA	2 cut(s)	291, 606
BcoDI	GTCTC	3 cut(s)	153, 722, 758
BfaI	CTAG	2 cut(s)	583, 875
BfmI	CTRYAG	1 cut(s)	383
BfuI	GTATCC	1 cut(s)	145
BglII	AGATCT	1 cut(s)	796
BmcAI	AGTACT	1 cut(s)	112
Bme1390I	CCNGG	1 cut(s)	183
BmgBI	CACGTC	1 cut(s)	580
BmgT120I	GGNCC	1 cut(s)	268
BmrFI	CCNGG	1 cut(s)	183
BmrI	ACTGGG	1 cut(s)	123
BmsI	GCATC	2 cut(s)	473, 880
BmuI	ACTGGG	1 cut(s)	123
BpmI	CTGGAG	1 cut(s)	942
Bpu10I	CCTNAGC	1 cut(s)	305
BsaBI	GATNNNNATC	1 cut(s)	290
BsaI	GGTCTC	2 cut(s)	722, 758
Bse1I	ACTGG	3 cut(s)	118, 361, 959
Bse8I	GATNNNNATC	1 cut(s)	290
BseBI	CCWGG	1 cut(s)	183
BseGI	GGATG	4 cut(s)	291, 468, 552, 609
BseJI	GATNNNNATC	1 cut(s)	290
BseMII	CTCAG	6 cut(s)	79, 296, 392, 532, 788, 916
BseNI	ACTGG	3 cut(s)	118, 361, 959
BseRI	GAGGAG	2 cut(s)	17, 322
BsgI	GTGCAG	2 cut(s)	509, 967
BshFI	GGCC	3 cut(s)	181, 269, 576
BslFI	GGGAC	1 cut(s)	820
BsmAI	GTCTC	3 cut(s)	153, 722, 758
BsmFI	GGGAC	1 cut(s)	820
BsnI	GGCC	3 cut(s)	181, 269, 576
Bso31I	GGTCTC	2 cut(s)	722, 758
Bsp143I	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
BspACI	CCGC	1 cut(s)	256
BspANI	GGCC	3 cut(s)	181, 269, 576
BspCNI	CTCAG	6 cut(s)	80, 297, 393, 531, 787, 917
BspHI	TCATGA	2 cut(s)	195, 768
BspPI	GGATC	3 cut(s)	247, 373, 649
BspTNI	GGTCTC	2 cut(s)	722, 758
BsrI	ACTGG	3 cut(s)	118, 361, 959
BssMI	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
Bst2UI	CCWGG	1 cut(s)	183
Bst4CI	ACNGT	5 cut(s)	75, 396, 455, 733, 941
Bst6I	CTCTTC	1 cut(s)	461
BstC8I	GCNNGC	3 cut(s)	488, 950, 954
BstDEI	CTNAG	6 cut(s)	88, 305, 401, 518, 774, 925
BstF5I	GGATG	4 cut(s)	291, 468, 552, 609
BstKTI	GATC	8 cut(s)	54, 255, 294, 381, 609, 628, 644, 799
BstMAI	GTCTC	3 cut(s)	153, 722, 758
BstMBI	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
BstNI	CCWGG	1 cut(s)	183
BstSCI	CCNGG	1 cut(s)	181
BstSFI	CTRYAG	1 cut(s)	383
BstX2I	RGATCY	2 cut(s)	252, 796
BstYI	RGATCY	2 cut(s)	252, 796
BsuI	GTATCC	1 cut(s)	145
BsuRI	GGCC	3 cut(s)	181, 269, 576
BtrI	CACGTC	1 cut(s)	580
BtsCI	GGATG	4 cut(s)	291, 468, 552, 609
BtsI	GCAGTG	2 cut(s)	675, 708
BtsIMutI	CAGTG	6 cut(s)	401, 626, 675, 708, 922, 950
Cac8I	GCNNGC	3 cut(s)	488, 950, 954
CaiI	CAGNNNCTG	2 cut(s)	400, 496
CciI	TCATGA	2 cut(s)	195, 768
Cfr13I	GGNCC	1 cut(s)	268
Csp6I	GTAC	2 cut(s)	111, 676
CspCI	CAANNNNNGTGG	2 cut(s)	617, 652
CviAII	CATG	7 cut(s)	156, 196, 238, 537, 613, 769, 829
CviJI	RGCY	8 cut(s)	15, 181, 193, 269, 439, 576, 762, 956
CviKI_1	RGCY	8 cut(s)	15, 181, 193, 269, 439, 576, 762, 956
CviQI	GTAC	2 cut(s)	111, 676
DdeI	CTNAG	6 cut(s)	88, 305, 401, 518, 774, 925
DpnI	GATC	8 cut(s)	53, 254, 293, 380, 608, 627, 643, 798
DpnII	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
Eam1104I	CTCTTC	1 cut(s)	461
EarI	CTCTTC	1 cut(s)	461
Eco147I	AGGCCT	1 cut(s)	181
Eco31I	GGTCTC	2 cut(s)	722, 758
EcoRII	CCWGG	1 cut(s)	181
FaeI	CATG	7 cut(s)	159, 199, 241, 540, 616, 772, 832
FaqI	GGGAC	1 cut(s)	820
FatI	CATG	7 cut(s)	155, 195, 237, 536, 612, 768, 828
FbaI	TGATCA	2 cut(s)	291, 606
FokI	GGATG	4 cut(s)	298, 475, 559, 616
FspBI	CTAG	2 cut(s)	583, 875
GsuI	CTGGAG	1 cut(s)	942
HaeIII	GGCC	3 cut(s)	181, 269, 576
Hin1II	CATG	7 cut(s)	159, 199, 241, 540, 616, 772, 832
HinfI	GANTC	5 cut(s)	118, 313, 389, 743, 772
HphI	GGTGA	2 cut(s)	91, 340
Hpy166II	GTNNAC	1 cut(s)	826
Hpy188I	TCNGA	7 cut(s)	51, 123, 521, 560, 727, 758, 777
Hpy188III	TCNNGA	5 cut(s)	196, 250, 583, 769, 875
Hpy8I	GTNNAC	1 cut(s)	826
HpyAV	CCTTC	4 cut(s)	566, 700, 733, 892
HpyCH4III	ACNGT	5 cut(s)	75, 396, 455, 733, 941
HpyCH4IV	ACGT	1 cut(s)	579
HpyCH4V	TGCA	4 cut(s)	37, 490, 871, 948
HpyF3I	CTNAG	6 cut(s)	88, 305, 401, 518, 774, 925
HpySE526I	ACGT	1 cut(s)	579
Hsp92II	CATG	7 cut(s)	159, 199, 241, 540, 616, 772, 832
Ksp22I	TGATCA	2 cut(s)	291, 606
Kzo9I	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
LmnI	GCTCC	1 cut(s)	961
LweI	GCATC	2 cut(s)	473, 880
MaeI	CTAG	2 cut(s)	583, 875
MaeII	ACGT	1 cut(s)	579
MaeIII	GTNAC	5 cut(s)	214, 334, 369, 396, 513
MalI	GATC	8 cut(s)	53, 254, 293, 380, 608, 627, 643, 798
MboI	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
MboII	GAAGA	3 cut(s)	52, 184, 478
MfeI	CAATTG	1 cut(s)	629
MflI	RGATCY	2 cut(s)	252, 796
MluCI	AATT	5 cut(s)	32, 200, 477, 629, 662
MlyI	GAGTC	2 cut(s)	752, 766
MmeI	TCCRAC	1 cut(s)	672
MseI	TTAA	1 cut(s)	433
MslI	CAYNNNNRTG	1 cut(s)	242
MspR9I	CCNGG	1 cut(s)	183
MunI	CAATTG	1 cut(s)	629
MvaI	CCWGG	1 cut(s)	183
NdeII	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
NlaIII	CATG	7 cut(s)	159, 199, 241, 540, 616, 772, 832
NmuCI	GTSAC	3 cut(s)	214, 396, 513
PagI	TCATGA	2 cut(s)	195, 768
PceI	AGGCCT	1 cut(s)	181
PfeI	GAWTC	3 cut(s)	118, 313, 389
PleI	GAGTC	2 cut(s)	751, 766
PpsI	GAGTC	2 cut(s)	751, 766
Psp6I	CCWGG	1 cut(s)	181
PspGI	CCWGG	1 cut(s)	181
PspPI	GGNCC	1 cut(s)	268
PstNI	CAGNNNCTG	2 cut(s)	400, 496
PsuI	RGATCY	2 cut(s)	252, 796
RsaI	GTAC	2 cut(s)	112, 677
RsaNI	GTAC	2 cut(s)	111, 676
RseI	CAYNNNNRTG	1 cut(s)	242
SaqAI	TTAA	1 cut(s)	433
Sau3AI	GATC	8 cut(s)	51, 252, 291, 378, 606, 625, 641, 796
Sau96I	GGNCC	1 cut(s)	268
ScaI	AGTACT	1 cut(s)	112
SchI	GAGTC	2 cut(s)	752, 766
ScrFI	CCNGG	1 cut(s)	183
SetI	ASST	6 cut(s)	9, 168, 498, 582, 699, 958
SfaNI	GCATC	2 cut(s)	473, 880
SfcI	CTRYAG	1 cut(s)	383
SmiMI	CAYNNNNRTG	1 cut(s)	242
Sse9I	AATT	5 cut(s)	32, 200, 477, 629, 662
SseBI	AGGCCT	1 cut(s)	181
SsiI	CCGC	1 cut(s)	256
SspMI	CTAG	2 cut(s)	583, 875
StuI	AGGCCT	1 cut(s)	181
StyD4I	CCNGG	1 cut(s)	181
TaaI	ACNGT	5 cut(s)	75, 396, 455, 733, 941
TaiI	ACGT	1 cut(s)	582
TasI	AATT	5 cut(s)	32, 200, 477, 629, 662
TatI	WGTACW	1 cut(s)	110
TfiI	GAWTC	3 cut(s)	118, 313, 389
Tru1I	TTAA	1 cut(s)	433
Tru9I	TTAA	1 cut(s)	433
TscAI	CASTG	6 cut(s)	401, 626, 675, 708, 929, 950
TseFI	GTSAC	3 cut(s)	214, 396, 513
Tsp45I	GTSAC	3 cut(s)	214, 396, 513
TspDTI	ATGAA	7 cut(s)	140, 212, 236, 479, 542, 752, 899
TspRI	CASTG	6 cut(s)	401, 626, 675, 708, 929, 950
XapI	RAATTY	1 cut(s)	477
XbaI	TCTAGA	2 cut(s)	582, 874
XcmI	CCANNNNNNNNNTGG	1 cut(s)	110
XspI	CTAG	2 cut(s)	583, 875
ZrmI	AGTACT	1 cut(s)	112

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.