Rmu_co8348777.1_g000001

Mitochondrial import inner membrane translocase subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8348777.1
Physical Location & Seq
Forward (+)
45 .. 830
786 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8348777.1_g000001.1.cds

Sequence Viewer

Length: 351 bp
atggctgcaaggattcttgccaacttgcttgtggttggctcaggagtgttggccagggcttttgttcaagcataccgccaggcacttacaaatgcctcgaagactggcgttgctcatgaagcagcacagagtattaggagagcaagcaaaactatggctgaaggagaggcaaggcaggtattaggtgtcactgagcatgcatcatgggaggagattgtgcagagatatgacaccatgttcgagcggaatgcgaaaaacggaagcttttatctccagtcaaaggtccatagagctaaagaatgcttagaagacgtttacggaaagaaggctgaggggattactgatgcataa

Protein Analysis

116

Amino Acids

12.74

Weight (kDa)

9.16

Isoelectric Point (pI)

36.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012892)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 166
AccBSI CCGCTC 1 cut(s) 244
AciI CCGC 2 cut(s) 76, 244
AcoI YGGCCR 1 cut(s) 51
AcuI CTGAAG 1 cut(s) 180
AfiI CCNNNNNNNGG 1 cut(s) 280
AgsI TTSAA 1 cut(s) 68
AjnI CCWGG 2 cut(s) 53, 78
AluBI AGCT 2 cut(s) 264, 293
AluI AGCT 2 cut(s) 264, 293
AoxI GGCC 1 cut(s) 51
ApeKI GCWGC 2 cut(s) 5, 122
ArsI GACNNNNNNTTYG 2 cut(s) 221, 253
AspS9I GGNCC 1 cut(s) 283
AvaII GGWCC 1 cut(s) 283
BalI TGGCCA 1 cut(s) 53
BbsI GAAGAC 2 cut(s) 107, 315
BbvCI CCTCAGC 1 cut(s) 330
BbvI GCAGC 1 cut(s) 134
BcgI CGANNNNNNTGC 2 cut(s) 230, 264
BciT130I CCWGG 2 cut(s) 55, 80
BfuAI ACCTGC 1 cut(s) 166
BisI GCNGC 2 cut(s) 6, 123
BlsI GCNGC 2 cut(s) 7, 124
Bme1390I CCNGG 2 cut(s) 55, 80
Bme18I GGWCC 1 cut(s) 283
BmgT120I GGNCC 1 cut(s) 283
BmrFI CCNGG 2 cut(s) 55, 80
BmsI GCATC 2 cut(s) 209, 334
BpiI GAAGAC 2 cut(s) 107, 315
BpmI CTGGAG 1 cut(s) 257
Bpu10I CCTNAGC 2 cut(s) 40, 330
BsaJI CCNNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 280
Bse1I ACTGG 2 cut(s) 109, 274
BseBI CCWGG 2 cut(s) 55, 80
BseDI CCNNGG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 280
BseMII CTCAG 3 cut(s) 54, 183, 321
BseNI ACTGG 2 cut(s) 109, 274
BseRI GAGGAG 1 cut(s) 224
BseXI GCAGC 1 cut(s) 134
BsgI GTGCAG 1 cut(s) 239
BshFI GGCC 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 280
BsmI GAATGC 2 cut(s) 253, 305
BsnI GGCC 1 cut(s) 53
BspACI CCGC 2 cut(s) 76, 244
BspANI GGCC 1 cut(s) 53
BspCNI CTCAG 3 cut(s) 53, 184, 322
BspHI TCATGA 1 cut(s) 115
BspMI ACCTGC 1 cut(s) 166
BsrBI CCGCTC 1 cut(s) 244
BsrI ACTGG 2 cut(s) 109, 274
BssECI CCNNGG 1 cut(s) 54
Bst2UI CCWGG 2 cut(s) 55, 80
BstC8I GCNNGC 2 cut(s) 145, 198
BstDEI CTNAG 4 cut(s) 40, 192, 304, 330
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstNI CCWGG 2 cut(s) 55, 80
BstNSI RCATGY 1 cut(s) 200
BstSCI CCNGG 2 cut(s) 53, 78
BstV1I GCAGC 1 cut(s) 134
BstV2I GAAGAC 2 cut(s) 107, 315
BsuRI GGCC 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 189
BveI ACCTGC 1 cut(s) 166
Cac8I GCNNGC 2 cut(s) 145, 198
CciI TCATGA 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 283
CviAII CATG 4 cut(s) 116, 197, 204, 235
CviJI RGCY 8 cut(s) 5, 39, 53, 59, 158, 264, 293, 329
CviKI_1 RGCY 8 cut(s) 5, 39, 53, 59, 158, 264, 293, 329
DdeI CTNAG 4 cut(s) 40, 192, 304, 330
EaeI YGGCCR 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 283
Eco57I CTGAAG 1 cut(s) 180
EcoRII CCWGG 2 cut(s) 53, 78
EcoT22I ATGCAT 2 cut(s) 202, 349
FaeI CATG 4 cut(s) 119, 200, 207, 238
FaiI YATR 9 cut(s) 73, 117, 155, 198, 205, 228, 236, 288, 349
FatI CATG 4 cut(s) 115, 196, 203, 234
Fnu4HI GCNGC 2 cut(s) 6, 123
Fsp4HI GCNGC 2 cut(s) 6, 123
GluI GCNGC 2 cut(s) 6, 123
GsuI CTGGAG 1 cut(s) 257
HaeIII GGCC 1 cut(s) 53
Hin1II CATG 4 cut(s) 119, 200, 207, 238
HindIII AAGCTT 1 cut(s) 262
HinfI GANTC 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 316
Hpy188III TCNNGA 2 cut(s) 42, 116
Hpy8I GTNNAC 1 cut(s) 316
HpyAV CCTTC 2 cut(s) 155, 319
HpyCH4IV ACGT 1 cut(s) 312
HpyCH4V TGCA 4 cut(s) 8, 200, 220, 347
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 4 cut(s) 40, 192, 304, 330
HpySE526I ACGT 1 cut(s) 312
Hsp92II CATG 4 cut(s) 119, 200, 207, 238
LpnPI CCDG 8 cut(s) 27, 40, 65, 67, 90, 92, 161, 287
Lsp1109I GCAGC 1 cut(s) 134
LweI GCATC 2 cut(s) 209, 334
MaeII ACGT 1 cut(s) 312
MaeIII GTNAC 1 cut(s) 187
MbiI CCGCTC 1 cut(s) 244
MboII GAAGA 2 cut(s) 112, 320
MlsI TGGCCA 1 cut(s) 53
MluNI TGGCCA 1 cut(s) 53
MnlI CCTC 4 cut(s) 106, 160, 202, 325
Mox20I TGGCCA 1 cut(s) 53
Mph1103I ATGCAT 2 cut(s) 202, 349
MscI TGGCCA 1 cut(s) 53
Msp20I TGGCCA 1 cut(s) 53
MspR9I CCNGG 2 cut(s) 55, 80
Mva1269I GAATGC 2 cut(s) 253, 305
MvaI CCWGG 2 cut(s) 55, 80
MwoI GCNNNNNNNGC 1 cut(s) 119
NlaIII CATG 4 cut(s) 119, 200, 207, 238
NmuCI GTSAC 1 cut(s) 187
NsiI ATGCAT 2 cut(s) 202, 349
NspI RCATGY 1 cut(s) 200
PaeI GCATGC 1 cut(s) 200
PagI TCATGA 1 cut(s) 115
PctI GAATGC 2 cut(s) 253, 305
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 2 cut(s) 7, 124
Psp6I CCWGG 2 cut(s) 53, 78
PspGI CCWGG 2 cut(s) 53, 78
PspPI GGNCC 1 cut(s) 283
SatI GCNGC 2 cut(s) 6, 123
Sau96I GGNCC 1 cut(s) 283
ScrFI CCNGG 2 cut(s) 55, 80
SetI ASST 6 cut(s) 180, 187, 266, 285, 295, 315
SfaNI GCATC 2 cut(s) 209, 334
SinI GGWCC 1 cut(s) 283
SphI GCATGC 1 cut(s) 200
SsiI CCGC 2 cut(s) 76, 244
StyD4I CCNGG 2 cut(s) 53, 78
TaiI ACGT 1 cut(s) 315
TaqI TCGA 2 cut(s) 98, 240
TfiI GAWTC 1 cut(s) 13
TscAI CASTG 1 cut(s) 196
TseFI GTSAC 1 cut(s) 187
TseI GCWGC 2 cut(s) 5, 122
Tsp45I GTSAC 1 cut(s) 187
TspDTI ATGAA 1 cut(s) 132
TspGWI ACGGA 2 cut(s) 273, 333
TspRI CASTG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 283
XceI RCATGY 1 cut(s) 200
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
Zsp2I ATGCAT 2 cut(s) 202, 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.