Rmu_co8360857.1_g000001

Protein LHCP TRANSLOCATION

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8360857.1
Physical Location & Seq
Forward (+)
1 .. 383
383 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8360857.1_g000001.1.cds

Sequence Viewer

Length: 258 bp
tatttcaactacatgggaatgcttgctgttgagggtacgtatgataagatgaatgctcttttaagccaaaatatccacccagtagatattctattgttgatggctgcctcagaagctgacaagccgaaaattgaagaacttttaagagccggagctagttactctgttaaagatgctgatgggcgaacagctcttgatagggctgcaagtgatgaaattaaagacttcattcttggtttttcagttcaaaaagcatga

Protein Analysis

85

Amino Acids

9.33

Weight (kDa)

4.75

Isoelectric Point (pI)

41.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015956)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G50900
fragaria_vesca FvH4_3g22190
malus_domestica MD03G1207700.v1.1
prunus_persica Prupe.4G209000_v2.0.a1
pyrus_communis pycom03g15670 pycom11g19600
rosa_chinensis RchiOBHm_Chr5g0038151
rosa_laevigata RLG00000033835
rosa_multiflora Rmu_co8360857.1_g000001 Rmu_sc0002670.1_g000003
rosa_rugosa Rorug05G0171000
rosa_samantha Rh5BG262000 Rh5CG294100 Rh5DG271100
rosa_wichuraiana Rw5G024180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 37
AgsI TTSAA 3 cut(s) 7, 134, 248
AluBI AGCT 3 cut(s) 116, 155, 191
AluI AGCT 3 cut(s) 116, 155, 191
AlwNI CAGNNNCTG 1 cut(s) 116
ApeKI GCWGC 2 cut(s) 104, 203
BbvI GCAGC 2 cut(s) 91, 190
BccI CCATC 2 cut(s) 94, 173
BfaI CTAG 1 cut(s) 156
BisI GCNGC 2 cut(s) 105, 204
BlsI GCNGC 2 cut(s) 106, 205
BmrI ACTGGG 1 cut(s) 74
BmsI GCATC 1 cut(s) 163
BmuI ACTGGG 1 cut(s) 74
BsaAI YACGTR 1 cut(s) 39
Bse1I ACTGG 1 cut(s) 80
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 80
BseXI GCAGC 2 cut(s) 91, 190
BsiSI CCGG 1 cut(s) 150
BsmI GAATGC 2 cut(s) 24, 58
BspCNI CTCAG 1 cut(s) 122
BsrI ACTGG 1 cut(s) 80
BstBAI YACGTR 1 cut(s) 39
BstC8I GCNNGC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 109
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstSNI TACGTA 1 cut(s) 39
BstV1I GCAGC 2 cut(s) 91, 190
Cac8I GCNNGC 1 cut(s) 24
CaiI CAGNNNCTG 1 cut(s) 116
Csp6I GTAC 1 cut(s) 36
CviAII CATG 2 cut(s) 13, 255
CviJI RGCY 8 cut(s) 66, 104, 116, 124, 149, 155, 191, 203
CviKI_1 RGCY 8 cut(s) 66, 104, 116, 124, 149, 155, 191, 203
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 1 cut(s) 109
Eco105I TACGTA 1 cut(s) 39
FaeI CATG 2 cut(s) 16, 258
FaiI YATR 3 cut(s) 14, 42, 256
FatI CATG 2 cut(s) 12, 254
Fnu4HI GCNGC 2 cut(s) 105, 204
Fsp4HI GCNGC 2 cut(s) 105, 204
FspBI CTAG 1 cut(s) 156
GluI GCNGC 2 cut(s) 105, 204
HapII CCGG 1 cut(s) 150
Hin1II CATG 2 cut(s) 16, 258
HpaII CCGG 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 194
HpyCH4IV ACGT 1 cut(s) 38
HpyCH4V TGCA 1 cut(s) 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 109
HpySE526I ACGT 1 cut(s) 38
Hsp92II CATG 2 cut(s) 16, 258
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 2 cut(s) 93, 163
Lsp1109I GCAGC 2 cut(s) 91, 190
LweI GCATC 1 cut(s) 163
MaeI CTAG 1 cut(s) 156
MaeII ACGT 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 158
MboII GAAGA 1 cut(s) 146
MluCI AATT 2 cut(s) 129, 216
MnlI CCTC 2 cut(s) 25, 118
MseI TTAA 4 cut(s) 62, 143, 168, 219
MslI CAYNNNNRTG 1 cut(s) 17
MspI CCGG 1 cut(s) 150
Mva1269I GAATGC 2 cut(s) 24, 58
MwoI GCNNNNNNNGC 1 cut(s) 113
NlaIII CATG 2 cut(s) 16, 258
PctI GAATGC 2 cut(s) 24, 58
PkrI GCNGC 2 cut(s) 106, 205
Ppu21I YACGTR 1 cut(s) 39
PstNI CAGNNNCTG 1 cut(s) 116
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
RseI CAYNNNNRTG 1 cut(s) 17
SaqAI TTAA 4 cut(s) 62, 143, 168, 219
SatI GCNGC 2 cut(s) 105, 204
SetI ASST 4 cut(s) 41, 118, 157, 193
SfaNI GCATC 1 cut(s) 163
SgeI CNNG 9 cut(s) 25, 35, 92, 133, 162, 168, 206, 219, 245
SmiMI CAYNNNNRTG 1 cut(s) 17
SnaBI TACGTA 1 cut(s) 39
Sse9I AATT 2 cut(s) 129, 216
SspMI CTAG 1 cut(s) 156
TaiI ACGT 1 cut(s) 41
TasI AATT 2 cut(s) 129, 216
Tru1I TTAA 4 cut(s) 62, 143, 168, 219
Tru9I TTAA 4 cut(s) 62, 143, 168, 219
TseI GCWGC 2 cut(s) 104, 203
TspDTI ATGAA 3 cut(s) 65, 217, 228
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.