Rmu_sc0002670.1_g000003

Protein LHCP TRANSLOCATION

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002670.1
Physical Location & Seq
Forward (+)
11741 .. 14319
2579 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002670.1_g000003.1.cds

Sequence Viewer

Length: 528 bp
atggcttccattccatgtactactgcccctacccactcatgcttcgcctccaactccttcaattcttcaactttttcagtcaaactcaatacccagtttctgggtacccgaagtaggctgggtcgggtcagaccctttggtcttggaccctccaatggctccagagccaagtgctggttcaagttcggtaaaaacggtatagatgctgagggtgctggaatctatggaagccaatcccgtgatgattatgataaagatgatgttgagcagtatttcaactacatgggaatgcttgctgttgagggtacgtatgataagatgaatgctcttttaagccaaaatatccacccagtagatattctattgttgatggctgcctcagaagctgacaagccgaaaattgaagaacttttaagagccggagctagttactctgttaaagatgctgatgggcgaacagctcttgatagggctgcaagtgatgaaattaaagacttcattcttggtttttcagttcaaaaagcatga

Protein Analysis

175

Amino Acids

19.06

Weight (kDa)

6.11

Isoelectric Point (pI)

40.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015956)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G50900
fragaria_vesca FvH4_3g22190
malus_domestica MD03G1207700.v1.1
prunus_persica Prupe.4G209000_v2.0.a1
pyrus_communis pycom03g15670 pycom11g19600
rosa_chinensis RchiOBHm_Chr5g0038151
rosa_laevigata RLG00000033835
rosa_multiflora Rmu_co8360857.1_g000001 Rmu_sc0002670.1_g000003
rosa_rugosa Rorug05G0171000
rosa_samantha Rh5BG262000 Rh5CG294100 Rh5DG271100
rosa_wichuraiana Rw5G024180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 138
Acc65I GGTACC 1 cut(s) 104
AccB1I GGYRCC 1 cut(s) 104
AccB7I CCANNNNNTGG 2 cut(s) 100, 174
AfaI GTAC 3 cut(s) 19, 106, 307
AfiI CCNNNNNNNGG 4 cut(s) 100, 114, 155, 174
AgsI TTSAA 6 cut(s) 61, 69, 181, 277, 404, 518
AjuI GAANNNNNNNTTGG 2 cut(s) 161, 193
AluBI AGCT 3 cut(s) 386, 425, 461
AluI AGCT 3 cut(s) 386, 425, 461
AlwNI CAGNNNCTG 2 cut(s) 100, 386
ApeKI GCWGC 2 cut(s) 374, 473
Asp718I GGTACC 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 146
AvaII GGWCC 1 cut(s) 146
BanI GGYRCC 1 cut(s) 104
BbvCI CCTCAGC 1 cut(s) 207
BbvI GCAGC 2 cut(s) 361, 460
BccI CCATC 2 cut(s) 364, 443
BfaI CTAG 1 cut(s) 426
BisI GCNGC 2 cut(s) 375, 474
BlsI GCNGC 2 cut(s) 376, 475
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 146
BmiI GGNNCC 3 cut(s) 106, 148, 160
BmrI ACTGGG 2 cut(s) 88, 344
BmsI GCATC 2 cut(s) 193, 433
BmuI ACTGGG 2 cut(s) 88, 344
BpmI CTGGAG 1 cut(s) 145
Bpu10I CCTNAGC 1 cut(s) 207
BsaAI YACGTR 1 cut(s) 309
Bsc4I CCNNNNNNNGG 4 cut(s) 100, 114, 155, 174
Bse1I ACTGG 2 cut(s) 94, 350
BseLI CCNNNNNNNGG 4 cut(s) 100, 114, 155, 174
BseMII CTCAG 2 cut(s) 198, 393
BseNI ACTGG 2 cut(s) 94, 350
BseXI GCAGC 2 cut(s) 361, 460
BseYI CCCAGC 1 cut(s) 118
BshNI GGYRCC 1 cut(s) 104
BsiSI CCGG 1 cut(s) 420
BslI CCNNNNNNNGG 4 cut(s) 100, 114, 155, 174
BsmI GAATGC 2 cut(s) 294, 328
BspCNI CTCAG 2 cut(s) 199, 392
BspLI GGNNCC 3 cut(s) 106, 148, 160
BspT107I GGYRCC 1 cut(s) 104
BsrI ACTGG 2 cut(s) 94, 350
Bst4CI ACNGT 1 cut(s) 197
BstBAI YACGTR 1 cut(s) 309
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 2 cut(s) 207, 379
BstMWI GCNNNNNNNGC 2 cut(s) 212, 383
BstSNI TACGTA 1 cut(s) 309
BstV1I GCAGC 2 cut(s) 361, 460
Cac8I GCNNGC 1 cut(s) 294
CaiI CAGNNNCTG 2 cut(s) 100, 386
Cfr13I GGNCC 1 cut(s) 146
Csp6I GTAC 3 cut(s) 18, 105, 306
CviAII CATG 4 cut(s) 15, 39, 283, 525
CviQI GTAC 3 cut(s) 18, 105, 306
DdeI CTNAG 2 cut(s) 207, 379
DrdI GACNNNNNNGTC 1 cut(s) 138
DseDI GACNNNNNNGTC 1 cut(s) 138
Eco105I TACGTA 1 cut(s) 309
Eco47I GGWCC 1 cut(s) 146
FaeI CATG 4 cut(s) 18, 42, 286, 528
FaiI YATR 8 cut(s) 16, 40, 200, 225, 249, 284, 312, 526
FatI CATG 4 cut(s) 14, 38, 282, 524
Fnu4HI GCNGC 2 cut(s) 375, 474
Fsp4HI GCNGC 2 cut(s) 375, 474
FspBI CTAG 1 cut(s) 426
GluI GCNGC 2 cut(s) 375, 474
GsaI CCCAGC 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 145
HapII CCGG 1 cut(s) 420
Hin1II CATG 4 cut(s) 18, 42, 286, 528
HinfI GANTC 1 cut(s) 219
HpaII CCGG 1 cut(s) 420
Hpy188I TCNGA 2 cut(s) 131, 382
Hpy188III TCNNGA 2 cut(s) 162, 464
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 1 cut(s) 197
HpyCH4IV ACGT 1 cut(s) 308
HpyCH4V TGCA 1 cut(s) 476
HpyF10VI GCNNNNNNNGC 2 cut(s) 212, 383
HpyF3I CTNAG 2 cut(s) 207, 379
HpySE526I ACGT 1 cut(s) 308
Hsp92II CATG 4 cut(s) 18, 42, 286, 528
KpnI GGTACC 1 cut(s) 108
LmnI GCTCC 2 cut(s) 164, 422
LpnPI CCDG 8 cut(s) 86, 104, 107, 160, 175, 201, 363, 433
Lsp1109I GCAGC 2 cut(s) 361, 460
LweI GCATC 2 cut(s) 193, 433
MaeI CTAG 1 cut(s) 426
MaeII ACGT 1 cut(s) 308
MaeIII GTNAC 1 cut(s) 428
MboII GAAGA 2 cut(s) 57, 416
MluCI AATT 3 cut(s) 61, 399, 486
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 5 cut(s) 58, 160, 202, 295, 388
MseI TTAA 4 cut(s) 332, 413, 438, 489
MslI CAYNNNNRTG 1 cut(s) 287
MspI CCGG 1 cut(s) 420
Mva1269I GAATGC 2 cut(s) 294, 328
MwoI GCNNNNNNNGC 2 cut(s) 212, 383
NlaIII CATG 4 cut(s) 18, 42, 286, 528
NlaIV GGNNCC 3 cut(s) 106, 148, 160
PctI GAATGC 2 cut(s) 294, 328
PfeI GAWTC 1 cut(s) 219
PflMI CCANNNNNTGG 2 cut(s) 100, 174
PkrI GCNGC 2 cut(s) 376, 475
Ppu21I YACGTR 1 cut(s) 309
PspFI CCCAGC 1 cut(s) 118
PspN4I GGNNCC 3 cut(s) 106, 148, 160
PspPI GGNCC 1 cut(s) 146
PstNI CAGNNNCTG 2 cut(s) 100, 386
RsaI GTAC 3 cut(s) 19, 106, 307
RsaNI GTAC 3 cut(s) 18, 105, 306
RseI CAYNNNNRTG 1 cut(s) 287
SaqAI TTAA 4 cut(s) 332, 413, 438, 489
SatI GCNGC 2 cut(s) 375, 474
Sau96I GGNCC 1 cut(s) 146
SetI ASST 4 cut(s) 311, 388, 427, 463
SfaNI GCATC 2 cut(s) 193, 433
SinI GGWCC 1 cut(s) 146
SmiMI CAYNNNNRTG 1 cut(s) 287
SnaBI TACGTA 1 cut(s) 309
Sse9I AATT 3 cut(s) 61, 399, 486
SspMI CTAG 1 cut(s) 426
TaaI ACNGT 1 cut(s) 197
TaiI ACGT 1 cut(s) 311
TasI AATT 3 cut(s) 61, 399, 486
TatI WGTACW 1 cut(s) 17
TfiI GAWTC 1 cut(s) 219
Tru1I TTAA 4 cut(s) 332, 413, 438, 489
Tru9I TTAA 4 cut(s) 332, 413, 438, 489
TseI GCWGC 2 cut(s) 374, 473
TspDTI ATGAA 3 cut(s) 335, 487, 498
Van91I CCANNNNNTGG 2 cut(s) 100, 174
VpaK11BI GGWCC 1 cut(s) 146
XspI CTAG 1 cut(s) 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.