Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8372183.1

Orthogroup ID

OG0008709

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 371

Gene Structure 371 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8372183.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 170 bp

ctgctaatgctagtagaattctggagggagagatgtttaagatgacaatatccaaaccgaagaatggtaatgcacaaaatctgcgagcagtacaagttgtaccattgaagactggttttcagccagcaattgtgaccttgagggaattgtatggagtaagaagctcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rep_fac-A_C

Protein Analysis

55

Amino Acids

6.03

Weight (kDa)

10.53

Isoelectric Point (pI)

32.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008709)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G28105 AT2G28105
fragaria_vesca	FvH4_3g30910 FvH4_3g30910 FvH4_3g30910 FvH4_3g30910 FvH4_3g30910
malus_domestica	MD11G1146400.v1.1
prunus_persica	Prupe.6G109500_v2.0.a1 Prupe.6G109500_v2.0.a1
pyrus_communis	pycom11g11940
rosa_chinensis	RchiOBHm_Chr5g0057451
rosa_laevigata	RLG00000035155
rosa_multiflora	Rmu_co8372183.1_g000001 Rmu_sc0003730.1_g000013 Rmu_sc0028908.1_g000001
rosa_roxburghii	Rroxscaffold_1G00023000
rosa_rugosa	Rorug05G0307400
rosa_samantha	Rh5AG375900 Rh5BG386700 Rh5CG410200 Rh5DG401000
rosa_wichuraiana	Rw5G035490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	17
AfaI	GTAC	2 cut(s)	92, 101
AfiI	CCNNNNNNNGG	1 cut(s)	64
AgsI	TTSAA	1 cut(s)	108
AluBI	AGCT	1 cut(s)	164
AluI	AGCT	1 cut(s)	164
ApoI	RAATTY	1 cut(s)	17
BbsI	GAAGAC	1 cut(s)	115
BfaI	CTAG	1 cut(s)	11
BpiI	GAAGAC	1 cut(s)	115
BpmI	CTGGAG	1 cut(s)	43
BpuEI	CTTGAG	1 cut(s)	159
Bsc4I	CCNNNNNNNGG	1 cut(s)	64
Bse1I	ACTGG	1 cut(s)	117
BseLI	CCNNNNNNNGG	1 cut(s)	64
BseNI	ACTGG	1 cut(s)	117
BslI	CCNNNNNNNGG	1 cut(s)	64
BsrI	ACTGG	1 cut(s)	117
BstC8I	GCNNGC	2 cut(s)	86, 125
BstV2I	GAAGAC	1 cut(s)	115
Cac8I	GCNNGC	2 cut(s)	86, 125
Csp6I	GTAC	2 cut(s)	91, 100
CviJI	RGCY	2 cut(s)	123, 164
CviKI_1	RGCY	2 cut(s)	123, 164
CviQI	GTAC	2 cut(s)	91, 100
EcoRI	GAATTC	1 cut(s)	17
FaiI	YATR	1 cut(s)	152
FalI	AAGNNNNNCTT	1 cut(s)	150
FspBI	CTAG	1 cut(s)	11
GsuI	CTGGAG	1 cut(s)	43
Hpy188III	TCNNGA	2 cut(s)	22, 167
HpyCH4V	TGCA	1 cut(s)	73
LpnPI	CCDG	3 cut(s)	7, 98, 137
MaeI	CTAG	1 cut(s)	11
MaeIII	GTNAC	1 cut(s)	132
MboII	GAAGA	2 cut(s)	72, 120
MfeI	CAATTG	1 cut(s)	128
MluCI	AATT	3 cut(s)	17, 128, 145
MnlI	CCTC	2 cut(s)	18, 134
MseI	TTAA	1 cut(s)	38
MunI	CAATTG	1 cut(s)	128
NmuCI	GTSAC	1 cut(s)	132
RsaI	GTAC	2 cut(s)	92, 101
RsaNI	GTAC	2 cut(s)	91, 100
SaqAI	TTAA	1 cut(s)	38
SetI	ASST	2 cut(s)	139, 166
SgeI	CNNG	7 cut(s)	23, 34, 97, 106, 125, 136, 150
SmlI	CTYRAG	1 cut(s)	138
SmoI	CTYRAG	1 cut(s)	138
Sse9I	AATT	3 cut(s)	17, 128, 145
SspMI	CTAG	1 cut(s)	11
TasI	AATT	3 cut(s)	17, 128, 145
TatI	WGTACW	1 cut(s)	90
Tru1I	TTAA	1 cut(s)	38
Tru9I	TTAA	1 cut(s)	38
TseFI	GTSAC	1 cut(s)	132
Tsp45I	GTSAC	1 cut(s)	132
XapI	RAATTY	1 cut(s)	17
XspI	CTAG	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.