Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028908.1

Orthogroup ID

OG0008709

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 437

Gene Structure 437 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028908.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 310 bp

atggaagccaaagaacccacaacaatgatgtgcacacttctggcaatagaccacaccgacttctcttacagagcatgctccctctgcgagaggactctccctgacaacccatcttccctctgtagatactgcaacccctctgccttcaacccccgcttccctcgctccaaacgcttctttcgcattcttatgtcaattgcttcggataccaaggtgttcactgtcatatgctttgatagggtagccaaggtcctctttggttgctctgctgatgagtttttcgactttgcgaaatttcacccttttgctg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rep_fac-A_C

Protein Analysis

103

Amino Acids

11.84

Weight (kDa)

8.2

Isoelectric Point (pI)

33.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008709)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G28105 AT2G28105
fragaria_vesca	FvH4_3g30910 FvH4_3g30910 FvH4_3g30910 FvH4_3g30910 FvH4_3g30910
malus_domestica	MD11G1146400.v1.1
prunus_persica	Prupe.6G109500_v2.0.a1 Prupe.6G109500_v2.0.a1
pyrus_communis	pycom11g11940
rosa_chinensis	RchiOBHm_Chr5g0057451
rosa_laevigata	RLG00000035155
rosa_multiflora	Rmu_co8372183.1_g000001 Rmu_sc0003730.1_g000013 Rmu_sc0028908.1_g000001
rosa_roxburghii	Rroxscaffold_1G00023000
rosa_rugosa	Rorug05G0307400
rosa_samantha	Rh5AG375900 Rh5BG386700 Rh5CG410200 Rh5DG401000
rosa_wichuraiana	Rw5G035490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	154
AcsI	RAATTY	1 cut(s)	293
AgsI	TTSAA	1 cut(s)	148
Alw21I	GWGCWC	1 cut(s)	35
Alw44I	GTGCAC	1 cut(s)	31
ApaLI	GTGCAC	1 cut(s)	31
ApoI	RAATTY	1 cut(s)	293
AspS9I	GGNCC	1 cut(s)	250
AsuHPI	GGTGA	1 cut(s)	290
AvaII	GGWCC	1 cut(s)	250
BaeGI	GKGCMC	1 cut(s)	35
BaeI	ACNNNNGTAYC	2 cut(s)	198, 231
Bbv12I	GWGCWC	1 cut(s)	35
BccI	CCATC	1 cut(s)	118
BciVI	GTATCC	1 cut(s)	199
BfmI	CTRYAG	1 cut(s)	121
BfuI	GTATCC	1 cut(s)	199
Bme18I	GGWCC	1 cut(s)	250
BmgT120I	GGNCC	1 cut(s)	250
BsaJI	CCNNGG	2 cut(s)	210, 246
BseDI	CCNNGG	2 cut(s)	210, 246
BseSI	GKGCMC	1 cut(s)	35
BsiHKAI	GWGCWC	1 cut(s)	35
BsmI	GAATGC	1 cut(s)	183
Bsp1286I	GDGCHC	1 cut(s)	35
BspACI	CCGC	1 cut(s)	154
BssECI	CCNNGG	2 cut(s)	210, 246
BssT1I	CCWWGG	2 cut(s)	210, 246
Bst4CI	ACNGT	1 cut(s)	223
BstC8I	GCNNGC	1 cut(s)	76
BstMWI	GCNNNNNNNGC	4 cut(s)	84, 162, 171, 180
BstNSI	RCATGY	1 cut(s)	78
BstSFI	CTRYAG	1 cut(s)	121
BstSLI	GKGCMC	1 cut(s)	35
BsuI	GTATCC	1 cut(s)	199
BtsIMutI	CAGTG	1 cut(s)	219
Cac8I	GCNNGC	1 cut(s)	76
Cfr13I	GGNCC	1 cut(s)	250
CviAII	CATG	1 cut(s)	75
CviJI	RGCY	2 cut(s)	8, 245
CviKI_1	RGCY	2 cut(s)	8, 245
Eco130I	CCWWGG	2 cut(s)	210, 246
Eco47I	GGWCC	1 cut(s)	250
EcoO109I	RGGNCCY	1 cut(s)	250
EcoT14I	CCWWGG	2 cut(s)	210, 246
ErhI	CCWWGG	2 cut(s)	210, 246
FaeI	CATG	1 cut(s)	78
FaiI	YATR	4 cut(s)	76, 191, 227, 229
FalI	AAGNNNNNCTT	2 cut(s)	239, 271
FatI	CATG	1 cut(s)	74
FauI	CCCGC	1 cut(s)	161
FauNDI	CATATG	1 cut(s)	227
Hin1II	CATG	1 cut(s)	78
HinfI	GANTC	1 cut(s)	94
HphI	GGTGA	1 cut(s)	290
Hpy166II	GTNNAC	2 cut(s)	33, 219
Hpy188I	TCNGA	1 cut(s)	205
Hpy8I	GTNNAC	2 cut(s)	33, 219
HpyAV	CCTTC	1 cut(s)	154
HpyCH4III	ACNGT	1 cut(s)	223
HpyCH4V	TGCA	2 cut(s)	33, 132
HpyF10VI	GCNNNNNNNGC	4 cut(s)	84, 162, 171, 180
Hsp92II	CATG	1 cut(s)	78
LmnI	GCTCC	2 cut(s)	83, 170
LpnPI	CCDG	2 cut(s)	26, 114
MboII	GAAGA	1 cut(s)	105
MfeI	CAATTG	1 cut(s)	195
MhlI	GDGCHC	1 cut(s)	35
MluCI	AATT	2 cut(s)	195, 293
MlyI	GAGTC	1 cut(s)	88
MnlI	CCTC	6 cut(s)	84, 92, 128, 148, 171, 263
MslI	CAYNNNNRTG	2 cut(s)	23, 188
MunI	CAATTG	1 cut(s)	195
Mva1269I	GAATGC	1 cut(s)	183
MwoI	GCNNNNNNNGC	4 cut(s)	84, 162, 171, 180
NdeI	CATATG	1 cut(s)	227
NlaIII	CATG	1 cut(s)	78
NspI	RCATGY	1 cut(s)	78
PaeI	GCATGC	1 cut(s)	78
PctI	GAATGC	1 cut(s)	183
PleI	GAGTC	1 cut(s)	88
PpsI	GAGTC	1 cut(s)	88
PpuMI	RGGWCCY	1 cut(s)	250
Psp5II	RGGWCCY	1 cut(s)	250
PspPI	GGNCC	1 cut(s)	250
PspPPI	RGGWCCY	1 cut(s)	250
RseI	CAYNNNNRTG	2 cut(s)	23, 188
Sau96I	GGNCC	1 cut(s)	250
SchI	GAGTC	1 cut(s)	88
SduI	GDGCHC	1 cut(s)	35
SetI	ASST	2 cut(s)	216, 252
SfcI	CTRYAG	1 cut(s)	121
SgeI	CNNG	8 cut(s)	53, 87, 100, 113, 165, 174, 223, 259
SinI	GGWCC	1 cut(s)	250
SmiMI	CAYNNNNRTG	2 cut(s)	23, 188
SphI	GCATGC	1 cut(s)	78
Sse9I	AATT	2 cut(s)	195, 293
SsiI	CCGC	1 cut(s)	154
StyI	CCWWGG	2 cut(s)	210, 246
TaaI	ACNGT	1 cut(s)	223
TaqI	TCGA	1 cut(s)	282
TasI	AATT	2 cut(s)	195, 293
TscAI	CASTG	1 cut(s)	226
TspRI	CASTG	1 cut(s)	226
VneI	GTGCAC	1 cut(s)	31
VpaK11BI	GGWCC	1 cut(s)	250
XapI	RAATTY	1 cut(s)	293
XceI	RCATGY	1 cut(s)	78

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.