Rmu_co8416913.1_g000001

Potassium transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8416913.1
Physical Location & Seq
Forward (+)
112 .. 1253
1142 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8416913.1_g000001.1.cds

Sequence Viewer

Length: 318 bp
atggagccagaggctgcaacttcgacccctccccgtcccagaagccgtcctcagctttcatgggtcaatctctccagaaatttattacttgcatatcagagccttggtgtggtttatggggacctcagtacttctcctctctatgtttatactagcacatttctagggaagttgccgaaccatcacaatgaggaagcgatatttggtgcattttccttaattttttggacccttacactgatgcccttgctgaagtatgtctttatcctattgagtgcagacgataatggtgaaggtgcggttacacttgaagtttaa

Protein Analysis

105

Amino Acids

11.67

Weight (kDa)

5.14

Isoelectric Point (pI)

37.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 299
AcsI RAATTY 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 272
AfaI GTAC 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 1 cut(s) 311
AjuI GAANNNNNNNTTGG 2 cut(s) 186, 218
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AlwNI CAGNNNCTG 1 cut(s) 14
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 1 cut(s) 79
AspS9I GGNCC 2 cut(s) 121, 228
AsuHPI GGTGA 1 cut(s) 302
AvaII GGWCC 2 cut(s) 121, 228
BbvCI CCTCAGC 1 cut(s) 51
BccI CCATC 1 cut(s) 189
BceAI ACGGC 1 cut(s) 30
BfaI CTAG 2 cut(s) 153, 164
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
BmcAI AGTACT 1 cut(s) 130
Bme18I GGWCC 2 cut(s) 121, 228
BmgT120I GGNCC 2 cut(s) 121, 228
BmiI GGNNCC 3 cut(s) 6, 122, 230
BmsI GCATC 1 cut(s) 231
BpmI CTGGAG 1 cut(s) 58
Bpu10I CCTNAGC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 109
BseMII CTCAG 2 cut(s) 65, 139
BseRI GAGGAG 1 cut(s) 126
BsgI GTGCAG 1 cut(s) 297
BslFI GGGAC 2 cut(s) 21, 134
BslI CCNNNNNNNGG 1 cut(s) 109
BsmFI GGGAC 2 cut(s) 21, 134
BspACI CCGC 1 cut(s) 299
BspCNI CTCAG 2 cut(s) 64, 138
BspLI GGNNCC 3 cut(s) 6, 122, 230
BssECI CCNNGG 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 103
BstDEI CTNAG 2 cut(s) 51, 125
BtsIMutI CAGTG 1 cut(s) 236
CaiI CAGNNNCTG 1 cut(s) 14
Cfr13I GGNCC 2 cut(s) 121, 228
Csp6I GTAC 1 cut(s) 129
CviAII CATG 1 cut(s) 60
CviJI RGCY 5 cut(s) 7, 14, 45, 55, 102
CviKI_1 RGCY 5 cut(s) 7, 14, 45, 55, 102
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 2 cut(s) 51, 125
Eco130I CCWWGG 1 cut(s) 103
Eco47I GGWCC 2 cut(s) 121, 228
Eco57I CTGAAG 1 cut(s) 272
EcoO109I RGGNCCY 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 1 cut(s) 63
FaiI YATR 6 cut(s) 61, 94, 117, 144, 150, 258
FalI AAGNNNNNCTT 2 cut(s) 245, 277
FaqI GGGAC 2 cut(s) 21, 134
FatI CATG 1 cut(s) 59
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 2 cut(s) 153, 164
GluI GCNGC 1 cut(s) 15
GsuI CTGGAG 1 cut(s) 58
Hin1II CATG 1 cut(s) 63
HphI GGTGA 1 cut(s) 302
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 75
HpyAV CCTTC 1 cut(s) 287
HpyCH4V TGCA 4 cut(s) 17, 92, 209, 278
HpyF3I CTNAG 2 cut(s) 51, 125
Hsp92II CATG 1 cut(s) 63
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 21, 52, 88
LweI GCATC 1 cut(s) 231
MaeI CTAG 2 cut(s) 153, 164
MaeIII GTNAC 1 cut(s) 301
MluCI AATT 2 cut(s) 79, 219
MnlI CCTC 6 cut(s) 4, 39, 60, 134, 147, 184
MseI TTAA 2 cut(s) 218, 316
MslI CAYNNNNRTG 1 cut(s) 186
NlaIII CATG 1 cut(s) 63
NlaIV GGNNCC 3 cut(s) 6, 122, 230
PkrI GCNGC 1 cut(s) 16
PpuMI RGGWCCY 1 cut(s) 121
Psp5II RGGWCCY 1 cut(s) 121
PspN4I GGNNCC 3 cut(s) 6, 122, 230
PspPI GGNCC 2 cut(s) 121, 228
PspPPI RGGWCCY 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 14
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
RseI CAYNNNNRTG 1 cut(s) 186
SaqAI TTAA 2 cut(s) 218, 316
SatI GCNGC 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 121, 228
ScaI AGTACT 1 cut(s) 130
SetI ASST 3 cut(s) 57, 126, 298
SfaNI GCATC 1 cut(s) 231
SinI GGWCC 2 cut(s) 121, 228
SmiMI CAYNNNNRTG 1 cut(s) 186
Sse9I AATT 2 cut(s) 79, 219
SsiI CCGC 1 cut(s) 299
SspMI CTAG 2 cut(s) 153, 164
StyI CCWWGG 1 cut(s) 103
TaqI TCGA 1 cut(s) 23
TasI AATT 2 cut(s) 79, 219
TatI WGTACW 1 cut(s) 128
Tru1I TTAA 2 cut(s) 218, 316
Tru9I TTAA 2 cut(s) 218, 316
TscAI CASTG 1 cut(s) 243
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 48
TspRI CASTG 1 cut(s) 243
VpaK11BI GGWCC 2 cut(s) 121, 228
XapI RAATTY 1 cut(s) 79
XspI CTAG 2 cut(s) 153, 164
ZrmI AGTACT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.