Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000035.1

Orthogroup ID

OG0018950

Physical Location & Seq

Genomic Coordinates Forward (+)

93822 .. 94334

Gene Structure 513 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000035.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 513 bp

atgctgagagtaacatacaagctattggaggtgctttcagagggtctaggcctggataggaaggtattgaaatcccatatgggagatggagaagtggaactggaaatgaagataaatatgtacccgccatgcccacaacccgaactagcccttggcgttgagcctcacaccgacatgtctgccctcaccttactggtttcaaacgatgatcctggtcttcagctgtggaaagatgacaattgggttgttgtgaattacctgccacatgcagtctttattaacattggtgatcagatggaggtcttgagcaatggtaagtacaagagtattcttcacaggagcttggtgaacaagaagcggttacgcatgtcgtgggctgtgttcattgtgccgccacatgaagctgtgattgggcctctgcgggagcttgtggacgagcaaaatcctgccaaatactcaaccaaaacatatggtaaataccgacaccgcaaattcaacaacatcccacagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00941 ko01100 ko01110 map00941 map01100 map01110

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

170

Amino Acids

19.48

Weight (kDa)

7.85

Isoelectric Point (pI)

40.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018950)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0327961 RchiOBHm_Chr6g0295261
rosa_multiflora	Rmu_sc0000035.1_g000025 Rmu_sc0000675.1_g000057 Rmu_sc0030162.1_g000001 Rmu_sc0033102.1_g000001
rosa_roxburghii	Rroxscaffold_171G00441430
rosa_samantha	Rh1DG093200 Rh6CG377300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	267
AciI	CCGC	5 cut(s)	125, 358, 392, 421, 487
AclWI	GGATC	1 cut(s)	203
AcsI	RAATTY	1 cut(s)	491
AcuI	CTGAAG	1 cut(s)	203
AfaI	GTAC	2 cut(s)	122, 320
AflIII	ACRYGT	1 cut(s)	174
AgsI	TTSAA	3 cut(s)	70, 201, 496
AjnI	CCWGG	2 cut(s)	51, 211
AjuI	GAANNNNNNNTTGG	4 cut(s)	135, 167, 393, 425
AluBI	AGCT	5 cut(s)	22, 223, 342, 404, 427
AluI	AGCT	5 cut(s)	22, 223, 342, 404, 427
AlwI	GGATC	1 cut(s)	203
AoxI	GGCC	2 cut(s)	49, 413
ApoI	RAATTY	1 cut(s)	491
AspS9I	GGNCC	1 cut(s)	413
AsuHPI	GGTGA	3 cut(s)	178, 299, 358
BbsI	GAAGAC	1 cut(s)	209
BccI	CCATC	2 cut(s)	80, 289
BcgI	CGANNNNNNTGC	2 cut(s)	161, 195
BciT130I	CCWGG	2 cut(s)	53, 213
BclI	TGATCA	1 cut(s)	289
BfaI	CTAG	2 cut(s)	47, 146
BfuAI	ACCTGC	1 cut(s)	267
BisI	GCNGC	1 cut(s)	392
BlsI	GCNGC	1 cut(s)	393
Bme1390I	CCNGG	2 cut(s)	53, 213
BmgT120I	GGNCC	1 cut(s)	413
BmrFI	CCNGG	2 cut(s)	53, 213
BpiI	GAAGAC	1 cut(s)	209
BpuEI	CTTGAG	1 cut(s)	325
BsaJI	CCNNGG	1 cut(s)	151
Bse1I	ACTGG	2 cut(s)	105, 198
Bse3DI	GCAATG	1 cut(s)	316
BseBI	CCWGG	2 cut(s)	53, 213
BseDI	CCNNGG	1 cut(s)	151
BseGI	GGATG	1 cut(s)	501
BseMI	GCAATG	1 cut(s)	316
BseNI	ACTGG	2 cut(s)	105, 198
BshFI	GGCC	2 cut(s)	51, 415
BsnI	GGCC	2 cut(s)	51, 415
Bsp143I	GATC	2 cut(s)	208, 289
BspACI	CCGC	5 cut(s)	125, 358, 392, 421, 487
BspANI	GGCC	2 cut(s)	51, 415
BspMI	ACCTGC	1 cut(s)	267
BspPI	GGATC	1 cut(s)	203
BsrDI	GCAATG	1 cut(s)	316
BsrI	ACTGG	2 cut(s)	105, 198
BssECI	CCNNGG	1 cut(s)	151
BssMI	GATC	2 cut(s)	208, 289
BssT1I	CCWWGG	1 cut(s)	151
Bst2UI	CCWGG	2 cut(s)	53, 213
Bst4CI	ACNGT	1 cut(s)	510
BstDEI	CTNAG	1 cut(s)	5
BstF5I	GGATG	1 cut(s)	501
BstKTI	GATC	2 cut(s)	211, 292
BstMBI	GATC	2 cut(s)	208, 289
BstNI	CCWGG	2 cut(s)	53, 213
BstNSI	RCATGY	3 cut(s)	178, 269, 370
BstSCI	CCNGG	2 cut(s)	51, 211
BstV2I	GAAGAC	1 cut(s)	209
BsuRI	GGCC	2 cut(s)	51, 415
BtsCI	GGATG	1 cut(s)	501
BveI	ACCTGC	1 cut(s)	267
Cfr13I	GGNCC	1 cut(s)	413
Csp6I	GTAC	2 cut(s)	121, 319
CviAII	CATG	5 cut(s)	129, 175, 266, 367, 398
CviQI	GTAC	2 cut(s)	121, 319
DdeI	CTNAG	1 cut(s)	5
DpnI	GATC	2 cut(s)	210, 291
DpnII	GATC	2 cut(s)	208, 289
Eco130I	CCWWGG	1 cut(s)	151
Eco147I	AGGCCT	1 cut(s)	51
Eco57I	CTGAAG	1 cut(s)	203
EcoRII	CCWGG	2 cut(s)	51, 211
EcoT14I	CCWWGG	1 cut(s)	151
ErhI	CCWWGG	1 cut(s)	151
FaeI	CATG	5 cut(s)	132, 178, 269, 370, 401
FatI	CATG	5 cut(s)	128, 174, 265, 366, 397
FauI	CCCGC	2 cut(s)	132, 414
FauNDI	CATATG	2 cut(s)	78, 469
FbaI	TGATCA	1 cut(s)	289
Fnu4HI	GCNGC	1 cut(s)	392
FokI	GGATG	1 cut(s)	488
Fsp4HI	GCNGC	1 cut(s)	392
FspBI	CTAG	2 cut(s)	47, 146
GluI	GCNGC	1 cut(s)	392
HaeIII	GGCC	2 cut(s)	51, 415
Hin1II	CATG	5 cut(s)	132, 178, 269, 370, 401
HphI	GGTGA	3 cut(s)	178, 299, 358
Hpy166II	GTNNAC	2 cut(s)	349, 433
Hpy188I	TCNGA	2 cut(s)	40, 294
Hpy188III	TCNNGA	1 cut(s)	304
Hpy8I	GTNNAC	2 cut(s)	349, 433
HpyAV	CCTTC	1 cut(s)	55
HpyCH4III	ACNGT	1 cut(s)	510
HpyCH4V	TGCA	1 cut(s)	269
HpyF3I	CTNAG	1 cut(s)	5
Hsp92II	CATG	5 cut(s)	132, 178, 269, 370, 401
Ksp22I	TGATCA	1 cut(s)	289
Kzo9I	GATC	2 cut(s)	208, 289
LmnI	GCTCC	2 cut(s)	339, 424
LpnPI	CCDG	9 cut(s)	38, 65, 86, 179, 198, 225, 272, 322, 459
MaeI	CTAG	2 cut(s)	47, 146
MaeIII	GTNAC	2 cut(s)	10, 360
MalI	GATC	2 cut(s)	210, 291
MboI	GATC	2 cut(s)	208, 289
MboII	GAAGA	3 cut(s)	121, 209, 323
MfeI	CAATTG	1 cut(s)	238
MluCI	AATT	3 cut(s)	238, 253, 491
MnlI	CCTC	6 cut(s)	22, 34, 174, 194, 292, 426
MseI	TTAA	1 cut(s)	279
MslI	CAYNNNNRTG	1 cut(s)	173
MspA1I	CMGCKG	1 cut(s)	223
MspR9I	CCNGG	2 cut(s)	53, 213
MunI	CAATTG	1 cut(s)	238
MvaI	CCWGG	2 cut(s)	53, 213
NdeI	CATATG	2 cut(s)	78, 469
NdeII	GATC	2 cut(s)	208, 289
NlaIII	CATG	5 cut(s)	132, 178, 269, 370, 401
NspI	RCATGY	3 cut(s)	178, 269, 370
PceI	AGGCCT	1 cut(s)	51
PciI	ACATGT	1 cut(s)	174
PkrI	GCNGC	1 cut(s)	393
PscI	ACATGT	1 cut(s)	174
Psp6I	CCWGG	2 cut(s)	51, 211
PspGI	CCWGG	2 cut(s)	51, 211
PspPI	GGNCC	1 cut(s)	413
PvuII	CAGCTG	1 cut(s)	223
RsaI	GTAC	2 cut(s)	122, 320
RsaNI	GTAC	2 cut(s)	121, 319
RseI	CAYNNNNRTG	1 cut(s)	173
SaqAI	TTAA	1 cut(s)	279
SatI	GCNGC	1 cut(s)	392
Sau3AI	GATC	2 cut(s)	208, 289
Sau96I	GGNCC	1 cut(s)	413
ScrFI	CCNGG	2 cut(s)	53, 213
SmiMI	CAYNNNNRTG	1 cut(s)	173
SmlI	CTYRAG	1 cut(s)	304
SmoI	CTYRAG	1 cut(s)	304
Sse9I	AATT	3 cut(s)	238, 253, 491
SseBI	AGGCCT	1 cut(s)	51
SsiI	CCGC	5 cut(s)	125, 358, 392, 421, 487
SspMI	CTAG	2 cut(s)	47, 146
StuI	AGGCCT	1 cut(s)	51
StyD4I	CCNGG	2 cut(s)	51, 211
StyI	CCWWGG	1 cut(s)	151
TaaI	ACNGT	1 cut(s)	510
TasI	AATT	3 cut(s)	238, 253, 491
TatI	WGTACW	1 cut(s)	318
TauI	GCSGC	1 cut(s)	394
Tru1I	TTAA	1 cut(s)	279
Tru9I	TTAA	1 cut(s)	279
TspDTI	ATGAA	3 cut(s)	122, 373, 414
XapI	RAATTY	1 cut(s)	491
XceI	RCATGY	3 cut(s)	178, 269, 370
XcmI	CCANNNNNNNNNTGG	1 cut(s)	83
XspI	CTAG	2 cut(s)	47, 146

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.