Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0033102.1

Orthogroup ID

OG0018950

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 329

Gene Structure 329 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0033102.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 313 bp

atgttgagagtaacatacaagctattggaggtgctttcagagggtctaggcctggataggaaggtattgaaatcccatatgggagatggagaagtggaactggaaatgaagataaatatgtacccgccatgcccacaaccccaactagcccttggcgttgagcctcacaccgacatgtctgccctcaccttactggtttcaaacgatgatcctggtcttcagctgtggaaagatgacaattgggttgttgtgaattacctgccacatgcagtctttattaacattggtgatcagatggaggtcttgagcaatg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00941 ko01100 ko01110 map00941 map01100 map01110

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

104

Amino Acids

11.69

Weight (kDa)

4.55

Isoelectric Point (pI)

35.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018950)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0327961 RchiOBHm_Chr6g0295261
rosa_multiflora	Rmu_sc0000035.1_g000025 Rmu_sc0000675.1_g000057 Rmu_sc0030162.1_g000001 Rmu_sc0033102.1_g000001
rosa_roxburghii	Rroxscaffold_171G00441430
rosa_samantha	Rh1DG093200 Rh6CG377300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	267
AciI	CCGC	1 cut(s)	125
AclWI	GGATC	1 cut(s)	203
AcuI	CTGAAG	1 cut(s)	203
AfaI	GTAC	1 cut(s)	122
AflIII	ACRYGT	1 cut(s)	174
AgsI	TTSAA	2 cut(s)	70, 201
AjnI	CCWGG	2 cut(s)	51, 211
AluBI	AGCT	2 cut(s)	22, 223
AluI	AGCT	2 cut(s)	22, 223
AlwI	GGATC	1 cut(s)	203
AoxI	GGCC	1 cut(s)	49
AsuHPI	GGTGA	2 cut(s)	178, 299
BbsI	GAAGAC	1 cut(s)	209
BccI	CCATC	2 cut(s)	80, 289
BcgI	CGANNNNNNTGC	2 cut(s)	161, 195
BciT130I	CCWGG	2 cut(s)	53, 213
BclI	TGATCA	1 cut(s)	289
BfaI	CTAG	2 cut(s)	47, 146
BfuAI	ACCTGC	1 cut(s)	267
Bme1390I	CCNGG	2 cut(s)	53, 213
BmrFI	CCNGG	2 cut(s)	53, 213
BpiI	GAAGAC	1 cut(s)	209
BsaJI	CCNNGG	1 cut(s)	151
Bse1I	ACTGG	2 cut(s)	105, 198
BseBI	CCWGG	2 cut(s)	53, 213
BseDI	CCNNGG	1 cut(s)	151
BseNI	ACTGG	2 cut(s)	105, 198
BshFI	GGCC	1 cut(s)	51
BsnI	GGCC	1 cut(s)	51
Bsp143I	GATC	2 cut(s)	208, 289
BspACI	CCGC	1 cut(s)	125
BspANI	GGCC	1 cut(s)	51
BspMI	ACCTGC	1 cut(s)	267
BspPI	GGATC	1 cut(s)	203
BsrI	ACTGG	2 cut(s)	105, 198
BssECI	CCNNGG	1 cut(s)	151
BssMI	GATC	2 cut(s)	208, 289
BssT1I	CCWWGG	1 cut(s)	151
Bst2UI	CCWGG	2 cut(s)	53, 213
BstKTI	GATC	2 cut(s)	211, 292
BstMBI	GATC	2 cut(s)	208, 289
BstNI	CCWGG	2 cut(s)	53, 213
BstNSI	RCATGY	2 cut(s)	178, 269
BstSCI	CCNGG	2 cut(s)	51, 211
BstV2I	GAAGAC	1 cut(s)	209
BsuRI	GGCC	1 cut(s)	51
BveI	ACCTGC	1 cut(s)	267
Csp6I	GTAC	1 cut(s)	121
CviAII	CATG	3 cut(s)	129, 175, 266
CviJI	RGCY	5 cut(s)	22, 51, 149, 163, 223
CviKI_1	RGCY	5 cut(s)	22, 51, 149, 163, 223
CviQI	GTAC	1 cut(s)	121
DpnI	GATC	2 cut(s)	210, 291
DpnII	GATC	2 cut(s)	208, 289
Eco130I	CCWWGG	1 cut(s)	151
Eco147I	AGGCCT	1 cut(s)	51
Eco57I	CTGAAG	1 cut(s)	203
EcoRII	CCWGG	2 cut(s)	51, 211
EcoT14I	CCWWGG	1 cut(s)	151
ErhI	CCWWGG	1 cut(s)	151
FaeI	CATG	3 cut(s)	132, 178, 269
FaiI	YATR	7 cut(s)	16, 78, 80, 119, 130, 176, 267
FatI	CATG	3 cut(s)	128, 174, 265
FauI	CCCGC	1 cut(s)	132
FauNDI	CATATG	1 cut(s)	78
FbaI	TGATCA	1 cut(s)	289
FspBI	CTAG	2 cut(s)	47, 146
HaeIII	GGCC	1 cut(s)	51
Hin1II	CATG	3 cut(s)	132, 178, 269
HphI	GGTGA	2 cut(s)	178, 299
Hpy188I	TCNGA	2 cut(s)	40, 294
Hpy188III	TCNNGA	1 cut(s)	304
HpyAV	CCTTC	1 cut(s)	55
HpyCH4V	TGCA	1 cut(s)	269
Hsp92II	CATG	3 cut(s)	132, 178, 269
Ksp22I	TGATCA	1 cut(s)	289
Kzo9I	GATC	2 cut(s)	208, 289
LpnPI	CCDG	7 cut(s)	38, 65, 86, 179, 198, 225, 272
MaeI	CTAG	2 cut(s)	47, 146
MaeIII	GTNAC	1 cut(s)	10
MalI	GATC	2 cut(s)	210, 291
MboI	GATC	2 cut(s)	208, 289
MboII	GAAGA	2 cut(s)	121, 209
MfeI	CAATTG	1 cut(s)	238
MluCI	AATT	2 cut(s)	238, 253
MnlI	CCTC	5 cut(s)	22, 34, 174, 194, 292
MseI	TTAA	1 cut(s)	279
MslI	CAYNNNNRTG	1 cut(s)	173
MspA1I	CMGCKG	1 cut(s)	223
MspR9I	CCNGG	2 cut(s)	53, 213
MunI	CAATTG	1 cut(s)	238
MvaI	CCWGG	2 cut(s)	53, 213
NdeI	CATATG	1 cut(s)	78
NdeII	GATC	2 cut(s)	208, 289
NlaIII	CATG	3 cut(s)	132, 178, 269
NspI	RCATGY	2 cut(s)	178, 269
PceI	AGGCCT	1 cut(s)	51
PciI	ACATGT	1 cut(s)	174
PscI	ACATGT	1 cut(s)	174
Psp6I	CCWGG	2 cut(s)	51, 211
PspGI	CCWGG	2 cut(s)	51, 211
PvuII	CAGCTG	1 cut(s)	223
RsaI	GTAC	1 cut(s)	122
RsaNI	GTAC	1 cut(s)	121
RseI	CAYNNNNRTG	1 cut(s)	173
SaqAI	TTAA	1 cut(s)	279
Sau3AI	GATC	2 cut(s)	208, 289
ScrFI	CCNGG	2 cut(s)	53, 213
SetI	ASST	7 cut(s)	24, 33, 66, 191, 225, 261, 303
SmiMI	CAYNNNNRTG	1 cut(s)	173
SmlI	CTYRAG	1 cut(s)	304
SmoI	CTYRAG	1 cut(s)	304
Sse9I	AATT	2 cut(s)	238, 253
SseBI	AGGCCT	1 cut(s)	51
SsiI	CCGC	1 cut(s)	125
SspMI	CTAG	2 cut(s)	47, 146
StuI	AGGCCT	1 cut(s)	51
StyD4I	CCNGG	2 cut(s)	51, 211
StyI	CCWWGG	1 cut(s)	151
TasI	AATT	2 cut(s)	238, 253
Tru1I	TTAA	1 cut(s)	279
Tru9I	TTAA	1 cut(s)	279
TspDTI	ATGAA	1 cut(s)	122
XceI	RCATGY	2 cut(s)	178, 269
XcmI	CCANNNNNNNNNTGG	2 cut(s)	83, 149
XspI	CTAG	2 cut(s)	47, 146

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.