Rmu_sc0030162.1_g000001

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030162.1
Physical Location & Seq
Reverse (-)
4199 .. 4711
513 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030162.1_g000001.1.cds

Sequence Viewer

Length: 513 bp
atgctgagagtaacatacaagctattggaggtgctttcagagggtctaggcctggataggaaggtattgaaatcccatatgggagatggagaagtggaactggaaatgaagataaatatgtacccgccatgcccacaacccgaactagcccttggcgttgagcctcacaccgacatgtctgccctcaccttactggtttcaaacgatgatcctggtcttcagctgtggaaagatgacaattgggttgctgtgaattacctgccacatgcagtctttattaacattggtgatcagatggaggtcttgagcaatggtaagtacaagagtattcttcacaggagcttggtgaacaagaagcggttacgcatgtcgtgggctgtgttcattgtgccgccacatgaagctgtgattgggcctctgcgggagcttgtggacgagcaaaatcctgccaaatactcaaccaaaacatatggtaaataccgacaccgcaaattcaacaacatcccacagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

170

Amino Acids

19.45

Weight (kDa)

7.85

Isoelectric Point (pI)

40.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 267
AciI CCGC 5 cut(s) 125, 358, 392, 421, 487
AclWI GGATC 1 cut(s) 203
AcsI RAATTY 1 cut(s) 491
AcuI CTGAAG 1 cut(s) 203
AfaI GTAC 2 cut(s) 122, 320
AflIII ACRYGT 1 cut(s) 174
AgsI TTSAA 3 cut(s) 70, 201, 496
AjnI CCWGG 2 cut(s) 51, 211
AjuI GAANNNNNNNTTGG 4 cut(s) 135, 167, 393, 425
AluBI AGCT 5 cut(s) 22, 223, 342, 404, 427
AluI AGCT 5 cut(s) 22, 223, 342, 404, 427
AlwI GGATC 1 cut(s) 203
AoxI GGCC 2 cut(s) 49, 413
ApoI RAATTY 1 cut(s) 491
AspS9I GGNCC 1 cut(s) 413
AsuHPI GGTGA 3 cut(s) 178, 299, 358
BbsI GAAGAC 1 cut(s) 209
BccI CCATC 2 cut(s) 80, 289
BcgI CGANNNNNNTGC 2 cut(s) 161, 195
BciT130I CCWGG 2 cut(s) 53, 213
BclI TGATCA 1 cut(s) 289
BfaI CTAG 2 cut(s) 47, 146
BfuAI ACCTGC 1 cut(s) 267
BisI GCNGC 1 cut(s) 392
BlsI GCNGC 1 cut(s) 393
Bme1390I CCNGG 2 cut(s) 53, 213
BmgT120I GGNCC 1 cut(s) 413
BmrFI CCNGG 2 cut(s) 53, 213
BpiI GAAGAC 1 cut(s) 209
BpuEI CTTGAG 1 cut(s) 325
BsaJI CCNNGG 1 cut(s) 151
Bse1I ACTGG 2 cut(s) 105, 198
Bse3DI GCAATG 1 cut(s) 316
BseBI CCWGG 2 cut(s) 53, 213
BseDI CCNNGG 1 cut(s) 151
BseGI GGATG 1 cut(s) 501
BseMI GCAATG 1 cut(s) 316
BseNI ACTGG 2 cut(s) 105, 198
BshFI GGCC 2 cut(s) 51, 415
BsnI GGCC 2 cut(s) 51, 415
Bsp143I GATC 2 cut(s) 208, 289
BspACI CCGC 5 cut(s) 125, 358, 392, 421, 487
BspANI GGCC 2 cut(s) 51, 415
BspMI ACCTGC 1 cut(s) 267
BspPI GGATC 1 cut(s) 203
BsrDI GCAATG 1 cut(s) 316
BsrI ACTGG 2 cut(s) 105, 198
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 2 cut(s) 208, 289
BssT1I CCWWGG 1 cut(s) 151
Bst2UI CCWGG 2 cut(s) 53, 213
Bst4CI ACNGT 1 cut(s) 510
BstDEI CTNAG 1 cut(s) 5
BstF5I GGATG 1 cut(s) 501
BstKTI GATC 2 cut(s) 211, 292
BstMBI GATC 2 cut(s) 208, 289
BstNI CCWGG 2 cut(s) 53, 213
BstNSI RCATGY 3 cut(s) 178, 269, 370
BstSCI CCNGG 2 cut(s) 51, 211
BstV2I GAAGAC 1 cut(s) 209
BsuRI GGCC 2 cut(s) 51, 415
BtsCI GGATG 1 cut(s) 501
BveI ACCTGC 1 cut(s) 267
Cfr13I GGNCC 1 cut(s) 413
Csp6I GTAC 2 cut(s) 121, 319
CviAII CATG 5 cut(s) 129, 175, 266, 367, 398
CviQI GTAC 2 cut(s) 121, 319
DdeI CTNAG 1 cut(s) 5
DpnI GATC 2 cut(s) 210, 291
DpnII GATC 2 cut(s) 208, 289
Eco130I CCWWGG 1 cut(s) 151
Eco147I AGGCCT 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 203
EcoRII CCWGG 2 cut(s) 51, 211
EcoT14I CCWWGG 1 cut(s) 151
ErhI CCWWGG 1 cut(s) 151
FaeI CATG 5 cut(s) 132, 178, 269, 370, 401
FatI CATG 5 cut(s) 128, 174, 265, 366, 397
FauI CCCGC 2 cut(s) 132, 414
FauNDI CATATG 2 cut(s) 78, 469
FbaI TGATCA 1 cut(s) 289
Fnu4HI GCNGC 1 cut(s) 392
FokI GGATG 1 cut(s) 488
Fsp4HI GCNGC 1 cut(s) 392
FspBI CTAG 2 cut(s) 47, 146
GluI GCNGC 1 cut(s) 392
HaeIII GGCC 2 cut(s) 51, 415
Hin1II CATG 5 cut(s) 132, 178, 269, 370, 401
HphI GGTGA 3 cut(s) 178, 299, 358
Hpy166II GTNNAC 2 cut(s) 349, 433
Hpy188I TCNGA 2 cut(s) 40, 294
Hpy188III TCNNGA 1 cut(s) 304
Hpy8I GTNNAC 2 cut(s) 349, 433
HpyAV CCTTC 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 510
HpyCH4V TGCA 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 5 cut(s) 132, 178, 269, 370, 401
Ksp22I TGATCA 1 cut(s) 289
Kzo9I GATC 2 cut(s) 208, 289
LmnI GCTCC 2 cut(s) 339, 424
LpnPI CCDG 9 cut(s) 38, 65, 86, 179, 198, 225, 272, 322, 459
MaeI CTAG 2 cut(s) 47, 146
MaeIII GTNAC 2 cut(s) 10, 360
MalI GATC 2 cut(s) 210, 291
MboI GATC 2 cut(s) 208, 289
MboII GAAGA 3 cut(s) 121, 209, 323
MfeI CAATTG 1 cut(s) 238
MluCI AATT 3 cut(s) 238, 253, 491
MnlI CCTC 6 cut(s) 22, 34, 174, 194, 292, 426
MseI TTAA 1 cut(s) 279
MslI CAYNNNNRTG 1 cut(s) 173
MspA1I CMGCKG 1 cut(s) 223
MspR9I CCNGG 2 cut(s) 53, 213
MunI CAATTG 1 cut(s) 238
MvaI CCWGG 2 cut(s) 53, 213
NdeI CATATG 2 cut(s) 78, 469
NdeII GATC 2 cut(s) 208, 289
NlaIII CATG 5 cut(s) 132, 178, 269, 370, 401
NspI RCATGY 3 cut(s) 178, 269, 370
PceI AGGCCT 1 cut(s) 51
PciI ACATGT 1 cut(s) 174
PkrI GCNGC 1 cut(s) 393
PscI ACATGT 1 cut(s) 174
Psp6I CCWGG 2 cut(s) 51, 211
PspGI CCWGG 2 cut(s) 51, 211
PspPI GGNCC 1 cut(s) 413
PvuII CAGCTG 1 cut(s) 223
RsaI GTAC 2 cut(s) 122, 320
RsaNI GTAC 2 cut(s) 121, 319
RseI CAYNNNNRTG 1 cut(s) 173
SaqAI TTAA 1 cut(s) 279
SatI GCNGC 1 cut(s) 392
Sau3AI GATC 2 cut(s) 208, 289
Sau96I GGNCC 1 cut(s) 413
ScrFI CCNGG 2 cut(s) 53, 213
SmiMI CAYNNNNRTG 1 cut(s) 173
SmlI CTYRAG 1 cut(s) 304
SmoI CTYRAG 1 cut(s) 304
Sse9I AATT 3 cut(s) 238, 253, 491
SseBI AGGCCT 1 cut(s) 51
SsiI CCGC 5 cut(s) 125, 358, 392, 421, 487
SspMI CTAG 2 cut(s) 47, 146
StuI AGGCCT 1 cut(s) 51
StyD4I CCNGG 2 cut(s) 51, 211
StyI CCWWGG 1 cut(s) 151
TaaI ACNGT 1 cut(s) 510
TasI AATT 3 cut(s) 238, 253, 491
TatI WGTACW 1 cut(s) 318
TauI GCSGC 1 cut(s) 394
Tru1I TTAA 1 cut(s) 279
Tru9I TTAA 1 cut(s) 279
TspDTI ATGAA 3 cut(s) 122, 373, 414
XapI RAATTY 1 cut(s) 491
XceI RCATGY 3 cut(s) 178, 269, 370
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
XspI CTAG 2 cut(s) 47, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.