Rmu_sc0000179.1_g000002

Chaperone protein DNAj

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000179.1
OG0013340
Physical Location & Seq
Forward (+)
13453 .. 18917
5465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000179.1_g000002.1.cds

Sequence Viewer

Length: 1407 bp
atgggctcgggttcgaaactggaaggcacatcagctttgcctatacggcgagacccctacgaagtcttgtgcgtttctagggattcatctgatcaggaaatcaaaaccgcctaccggaaactcgctctcaagtatcatccagacaagaatacgaacaatccggaagcggcagaacagttcaaggaggttgcgttttcgtatggcattttatctgacccggagaagaggaggcagtatgacaatgctggatttgaggctattgatgctgagggcatggacatggaaattgacttgtcaaatcttggaactgtcaatacaatgtttgcagctctattcagcaagttgggtgtccctatcaagactacaatttcagctaatgtgcttgaagaagctctaaatggtactgttacagttagacctctcccaattggaacatcagttagtggaaaggtggagaaacaatgtgcccacttttttggtgtaacaatcaatgaccaacaagccgaggcagggattgtagtaagagttacttcaactgcacaaagtaaatttaagttactttattttgagcaagatgccaatgctggctatggtttggccttacaggtggagaaacaatgtgcccacttttttggtgtaacaatcaatgaccaacaagccgaggcagggattgtagtgagagttacttcaaccgcacaaagtaaatttaagttactttattttgagcaagatgccaatgctggctatggtttggccttacaggaagatagtgaaaaaaccggcaaaataacatctgcaggaatgtattttctgcattttcaagtatacagaatggattcaactttgaatgcgttggccatggcaaaggatcctgaagctgctttttttaagaggttggaaggtcttcaaccctgcgaggtctcagaactaaaagctggcacacatatattcgctgtttatggagataatttttttaagactgctacgtatacaattgaggcactttgtgtggggtcatatgaggatacgacacacaagcttagagagattgaggctcaaatattaagaaagagaaatgagcttcgccaatttgagaccgagtacaggaaggcattggcacgctttcaagaagtgacaaatagatacacccaggaaaagctatctgtagatgagctgctgaaacaacgagacagtattcattcatctttcactgtcaccaggacagccaacaatgctgtgggtagtagtggtgtaagcaatggaagtagtagtagcaaaactcttggcgaagattcaagggcagagagcccaatggaggatggaggctcagatgggaaggataagtcagctaaaaagaaatggttcaatcttaacctcaaaggatcggcatcggataaaaagctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005515 GO:0008092 GO:0008150 GO:0009605 GO:0009606 GO:0009628 GO:0009629 GO:0009630 GO:0009958 GO:0050896
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

468

Amino Acids

51.64

Weight (kDa)

5.95

Isoelectric Point (pI)

28.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013340)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G68370
fragaria_vesca FvH4_4g27000
malus_domestica MD13G1039100.v1.1 MD16G1040000.v1.1
prunus_persica Prupe.1G314100_v2.0.a1 Prupe.1G314100_v2.0.a1 Prupe.1G314100_v2.0.a1
pyrus_communis pycom13g03360
rosa_chinensis RchiOBHm_Chr4g0434801
rosa_laevigata RLG00000006648
rosa_multiflora Rmu_sc0000179.1_g000002
rosa_roxburghii Rroxscaffold_5G00376010
rosa_rugosa Rorug04G0278500
rosa_samantha Rh4AG335000 Rh4BG343500 Rh4CG357900 Rh4DG337400
rosa_wichuraiana Rw4G029210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 825, 989
AccIII TCCGGA 1 cut(s) 160
AciI CCGC 3 cut(s) 108, 167, 693
AclWI GGATC 3 cut(s) 863, 876, 1390
AcoI YGGCCR 1 cut(s) 855
AcsI RAATTY 2 cut(s) 548, 704
AcuI CTGAAG 1 cut(s) 894
AdeI CACNNNGTG 1 cut(s) 1007
AfaI GTAC 2 cut(s) 403, 1103
AfiI CCNNNNNNNGG 5 cut(s) 114, 510, 666, 1104, 1315
AjnI CCWGG 2 cut(s) 1149, 1217
Alw26I GTCTC 4 cut(s) 45, 925, 1088, 1182
AlwI GGATC 3 cut(s) 863, 876, 1390
Ama87I CYCGRG 1 cut(s) 7
Aor13HI TCCGGA 1 cut(s) 160
AoxI GGCC 3 cut(s) 597, 753, 855
ApeKI GCWGC 3 cut(s) 326, 878, 1174
ApoI RAATTY 2 cut(s) 548, 704
Asp700I GAANNNNTTC 3 cut(s) 835, 903, 1361
AsuC2I CCSGG 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 1207
AsuII TTCGAA 1 cut(s) 14
AvaI CYCGRG 1 cut(s) 7
BaeGI GKGCMC 2 cut(s) 469, 625
BalI TGGCCA 1 cut(s) 857
BamHI GGATCC 1 cut(s) 868
BanII GRGCYC 2 cut(s) 8, 1310
BbsI GAAGAC 1 cut(s) 896
BbvCI CCTCAGC 1 cut(s) 267
BbvI GCAGC 3 cut(s) 338, 865, 1161
BccI CCATC 2 cut(s) 1313, 1325
BceAI ACGGC 1 cut(s) 62
BciT130I CCWGG 2 cut(s) 1151, 1219
BciVI GTATCC 1 cut(s) 1018
BclI TGATCA 1 cut(s) 91
BcnI CCSGG 1 cut(s) 218
BcoDI GTCTC 4 cut(s) 45, 925, 1088, 1182
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 2 cut(s) 795, 1164
BfuI GTATCC 1 cut(s) 1018
BglI GCCNNNNNGGC 1 cut(s) 46
BisI GCNGC 4 cut(s) 168, 327, 879, 1175
BlsI GCNGC 4 cut(s) 169, 328, 880, 1176
Bme1390I CCNGG 3 cut(s) 218, 1151, 1219
BmeT110I CYCGRG 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 870
BmrFI CCNGG 3 cut(s) 218, 1151, 1219
BmsI GCATC 4 cut(s) 253, 565, 721, 1397
BpiI GAAGAC 1 cut(s) 896
Bpu10I CCTNAGC 1 cut(s) 267
Bpu14I TTCGAA 1 cut(s) 14
BpuEI CTTGAG 1 cut(s) 113
BpuMI CCSGG 1 cut(s) 218
BsaAI YACGTR 1 cut(s) 987
BsaBI GATNNNNATC 1 cut(s) 1387
BsaI GGTCTC 3 cut(s) 45, 925, 1088
BsaJI CCNNGG 4 cut(s) 504, 660, 858, 1149
BsaWI WCCGGW 2 cut(s) 114, 160
BsaXI ACNNNNNCTCC 2 cut(s) 176, 206
Bsc4I CCNNNNNNNGG 5 cut(s) 114, 510, 666, 1104, 1315
Bse118I RCCGGY 1 cut(s) 779
Bse1I ACTGG 1 cut(s) 24
Bse3DI GCAATG 1 cut(s) 1264
Bse8I GATNNNNATC 1 cut(s) 1387
BseAI TCCGGA 1 cut(s) 160
BseBI CCWGG 2 cut(s) 1151, 1219
BseDI CCNNGG 4 cut(s) 504, 660, 858, 1149
BseGI GGATG 2 cut(s) 136, 1324
BseJI GATNNNNATC 1 cut(s) 1387
BseLI CCNNNNNNNGG 5 cut(s) 114, 510, 666, 1104, 1315
BseMI GCAATG 1 cut(s) 1264
BseMII CTCAG 3 cut(s) 258, 936, 1341
BseNI ACTGG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 241
BseSI GKGCMC 2 cut(s) 469, 625
BseXI GCAGC 3 cut(s) 338, 865, 1161
BsgI GTGCAG 1 cut(s) 522
BshFI GGCC 3 cut(s) 599, 755, 857
BsiHKCI CYCGRG 1 cut(s) 7
BsiSI CCGG 4 cut(s) 115, 161, 218, 780
BslFI GGGAC 1 cut(s) 335
BslI CCNNNNNNNGG 5 cut(s) 114, 510, 666, 1104, 1315
BsmAI GTCTC 4 cut(s) 45, 925, 1088, 1182
BsmFI GGGAC 1 cut(s) 335
BsmI GAATGC 1 cut(s) 853
BsnI GGCC 3 cut(s) 599, 755, 857
Bso31I GGTCTC 3 cut(s) 45, 925, 1088
BsoBI CYCGRG 1 cut(s) 7
Bsp119I TTCGAA 1 cut(s) 14
Bsp1286I GDGCHC 4 cut(s) 8, 469, 625, 1310
Bsp13I TCCGGA 1 cut(s) 160
Bsp143I GATC 3 cut(s) 91, 868, 1382
Bsp19I CCATGG 1 cut(s) 858
BspACI CCGC 3 cut(s) 108, 167, 693
BspANI GGCC 3 cut(s) 599, 755, 857
BspCNI CTCAG 3 cut(s) 259, 935, 1340
BspEI TCCGGA 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 870
BspMAI CTGCAG 1 cut(s) 799
BspPI GGATC 3 cut(s) 863, 876, 1390
BspT104I TTCGAA 1 cut(s) 14
BspTNI GGTCTC 3 cut(s) 45, 925, 1088
BsrDI GCAATG 1 cut(s) 1264
BsrFI RCCGGY 1 cut(s) 779
BsrI ACTGG 1 cut(s) 24
BssAI RCCGGY 1 cut(s) 779
BssECI CCNNGG 4 cut(s) 504, 660, 858, 1149
BssMI GATC 3 cut(s) 91, 868, 1382
BssNAI GTATAC 2 cut(s) 826, 990
BssT1I CCWWGG 1 cut(s) 858
Bst1107I GTATAC 2 cut(s) 826, 990
Bst2UI CCWGG 2 cut(s) 1151, 1219
Bst4CI ACNGT 6 cut(s) 177, 310, 406, 412, 1193, 1213
Bst6I CTCTTC 1 cut(s) 218
BstBAI YACGTR 1 cut(s) 987
BstBI TTCGAA 1 cut(s) 14
BstC8I GCNNGC 4 cut(s) 586, 742, 937, 1120
BstDEI CTNAG 4 cut(s) 267, 922, 1040, 1327
BstDSI CCRYGG 1 cut(s) 858
BstF5I GGATG 2 cut(s) 136, 1324
BstKTI GATC 3 cut(s) 94, 871, 1385
BstMAI GTCTC 4 cut(s) 45, 925, 1088, 1182
BstMBI GATC 3 cut(s) 91, 868, 1382
BstMWI GCNNNNNNNGC 3 cut(s) 46, 263, 1232
BstNI CCWGG 2 cut(s) 1151, 1219
BstSCI CCNGG 3 cut(s) 216, 1149, 1217
BstSFI CTRYAG 2 cut(s) 795, 1164
BstSLI GKGCMC 2 cut(s) 469, 625
BstSNI TACGTA 1 cut(s) 987
BstV1I GCAGC 3 cut(s) 338, 865, 1161
BstV2I GAAGAC 1 cut(s) 896
BstX2I RGATCY 1 cut(s) 868
BstXI CCANNNNNNTGG 2 cut(s) 476, 632
BstYI RGATCY 1 cut(s) 868
BstZ17I GTATAC 2 cut(s) 826, 990
BsuI GTATCC 1 cut(s) 1018
BsuRI GGCC 3 cut(s) 599, 755, 857
BtgI CCRYGG 1 cut(s) 858
BtsCI GGATG 2 cut(s) 136, 1324
BtsIMutI CAGTG 1 cut(s) 1209
Cac8I GCNNGC 4 cut(s) 586, 742, 937, 1120
Cfr10I RCCGGY 1 cut(s) 779
Csp6I GTAC 2 cut(s) 402, 1102
CviAII CATG 3 cut(s) 274, 280, 859
CviQI GTAC 2 cut(s) 402, 1102
DdeI CTNAG 4 cut(s) 267, 922, 1040, 1327
DpnI GATC 3 cut(s) 93, 870, 1384
DpnII GATC 3 cut(s) 91, 868, 1382
DraIII CACNNNGTG 1 cut(s) 1007
EaeI YGGCCR 1 cut(s) 855
Eam1104I CTCTTC 1 cut(s) 218
EarI CTCTTC 1 cut(s) 218
Eco105I TACGTA 1 cut(s) 987
Eco130I CCWWGG 1 cut(s) 858
Eco24I GRGCYC 2 cut(s) 8, 1310
Eco31I GGTCTC 3 cut(s) 45, 925, 1088
Eco57I CTGAAG 1 cut(s) 894
Eco88I CYCGRG 1 cut(s) 7
EcoRII CCWGG 2 cut(s) 1149, 1217
EcoT14I CCWWGG 1 cut(s) 858
EcoT38I GRGCYC 2 cut(s) 8, 1310
ErhI CCWWGG 1 cut(s) 858
FaeI CATG 3 cut(s) 277, 283, 862
FalI AAGNNNNNCTT 2 cut(s) 514, 546
FaqI GGGAC 1 cut(s) 335
FatI CATG 3 cut(s) 273, 279, 858
FauNDI CATATG 1 cut(s) 1018
FbaI TGATCA 1 cut(s) 91
FblI GTMKAC 2 cut(s) 825, 989
Fnu4HI GCNGC 4 cut(s) 168, 327, 879, 1175
FokI GGATG 2 cut(s) 123, 1331
FriOI GRGCYC 2 cut(s) 8, 1310
Fsp4HI GCNGC 4 cut(s) 168, 327, 879, 1175
FspBI CTAG 1 cut(s) 78
GluI GCNGC 4 cut(s) 168, 327, 879, 1175
HaeIII GGCC 3 cut(s) 599, 755, 857
HapII CCGG 4 cut(s) 115, 161, 218, 780
Hin1II CATG 3 cut(s) 277, 283, 862
HindIII AAGCTT 2 cut(s) 1037, 1400
HinfI GANTC 3 cut(s) 83, 836, 1292
HpaII CCGG 4 cut(s) 115, 161, 218, 780
HphI GGTGA 1 cut(s) 1207
Hpy166II GTNNAC 2 cut(s) 826, 990
Hpy188I TCNGA 5 cut(s) 91, 214, 925, 1330, 1393
Hpy188III TCNNGA 6 cut(s) 95, 140, 161, 358, 872, 1127
Hpy8I GTNNAC 2 cut(s) 826, 990
HpyAV CCTTC 4 cut(s) 17, 893, 1102, 1330
HpyCH4III ACNGT 6 cut(s) 177, 310, 406, 412, 1193, 1213
HpyCH4IV ACGT 1 cut(s) 986
HpyCH4V TGCA 4 cut(s) 326, 539, 797, 814
HpyF10VI GCNNNNNNNGC 3 cut(s) 46, 263, 1232
HpyF3I CTNAG 4 cut(s) 267, 922, 1040, 1327
HpySE526I ACGT 1 cut(s) 986
Hsp92II CATG 3 cut(s) 277, 283, 862
Kpn2I TCCGGA 1 cut(s) 160
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 3 cut(s) 91, 868, 1382
Lsp1109I GCAGC 3 cut(s) 338, 865, 1161
LweI GCATC 4 cut(s) 253, 565, 721, 1397
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 986
MaeIII GTNAC 9 cut(s) 406, 481, 526, 555, 637, 682, 711, 1132, 1213
MalI GATC 3 cut(s) 93, 870, 1384
MboI GATC 3 cut(s) 91, 868, 1382
MboII GAAGA 5 cut(s) 235, 398, 776, 896, 1301
MfeI CAATTG 2 cut(s) 426, 993
MflI RGATCY 1 cut(s) 868
MhlI GDGCHC 4 cut(s) 8, 469, 625, 1310
MlsI TGGCCA 1 cut(s) 857
MluCI AATT 8 cut(s) 285, 366, 426, 548, 704, 967, 993, 1088
MluNI TGGCCA 1 cut(s) 857
MmeI TCCRAC 1 cut(s) 876
Mox20I TGGCCA 1 cut(s) 857
MroI TCCGGA 1 cut(s) 160
MroXI GAANNNNTTC 3 cut(s) 835, 903, 1361
MscI TGGCCA 1 cut(s) 857
MseI TTAA 6 cut(s) 552, 708, 888, 975, 1064, 1371
MslI CAYNNNNRTG 1 cut(s) 278
Msp20I TGGCCA 1 cut(s) 857
MspI CCGG 4 cut(s) 115, 161, 218, 780
MspR9I CCNGG 3 cut(s) 218, 1151, 1219
MunI CAATTG 2 cut(s) 426, 993
Mva1269I GAATGC 1 cut(s) 853
MvaI CCWGG 2 cut(s) 1151, 1219
MwoI GCNNNNNNNGC 3 cut(s) 46, 263, 1232
NciI CCSGG 1 cut(s) 218
NcoI CCATGG 1 cut(s) 858
NdeI CATATG 1 cut(s) 1018
NdeII GATC 3 cut(s) 91, 868, 1382
NlaIII CATG 3 cut(s) 277, 283, 862
NlaIV GGNNCC 1 cut(s) 870
NmeAIII GCCGAG 2 cut(s) 529, 685
NmuCI GTSAC 2 cut(s) 1132, 1213
NspV TTCGAA 1 cut(s) 14
PctI GAATGC 1 cut(s) 853
PdmI GAANNNNTTC 3 cut(s) 835, 903, 1361
PfeI GAWTC 3 cut(s) 83, 836, 1292
PkrI GCNGC 4 cut(s) 169, 328, 880, 1176
Ppu21I YACGTR 1 cut(s) 987
Psp6I CCWGG 2 cut(s) 1149, 1217
PspGI CCWGG 2 cut(s) 1149, 1217
PspN4I GGNNCC 1 cut(s) 870
PsrI GAACNNNNNNTAC 2 cut(s) 298, 330
PstI CTGCAG 1 cut(s) 799
PsuI RGATCY 1 cut(s) 868
RsaI GTAC 2 cut(s) 403, 1103
RsaNI GTAC 2 cut(s) 402, 1102
RseI CAYNNNNRTG 1 cut(s) 278
SaqAI TTAA 6 cut(s) 552, 708, 888, 975, 1064, 1371
SatI GCNGC 4 cut(s) 168, 327, 879, 1175
Sau3AI GATC 3 cut(s) 91, 868, 1382
ScrFI CCNGG 3 cut(s) 218, 1151, 1219
SduI GDGCHC 4 cut(s) 8, 469, 625, 1310
SfaNI GCATC 4 cut(s) 253, 565, 721, 1397
SfcI CTRYAG 2 cut(s) 795, 1164
SfuI TTCGAA 1 cut(s) 14
SmiMI CAYNNNNRTG 1 cut(s) 278
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
SnaBI TACGTA 1 cut(s) 987
Sse9I AATT 8 cut(s) 285, 366, 426, 548, 704, 967, 993, 1088
SsiI CCGC 3 cut(s) 108, 167, 693
SspI AATATT 1 cut(s) 1062
SspMI CTAG 1 cut(s) 78
StyD4I CCNGG 3 cut(s) 216, 1149, 1217
StyI CCWWGG 1 cut(s) 858
TaaI ACNGT 6 cut(s) 177, 310, 406, 412, 1193, 1213
TaiI ACGT 1 cut(s) 989
TaqI TCGA 1 cut(s) 14
TaqII GACCGA 1 cut(s) 1112
TasI AATT 8 cut(s) 285, 366, 426, 548, 704, 967, 993, 1088
TatI WGTACW 1 cut(s) 1101
TauI GCSGC 1 cut(s) 170
TfiI GAWTC 3 cut(s) 83, 836, 1292
Tru1I TTAA 6 cut(s) 552, 708, 888, 975, 1064, 1371
Tru9I TTAA 6 cut(s) 552, 708, 888, 975, 1064, 1371
TscAI CASTG 1 cut(s) 1216
TseFI GTSAC 2 cut(s) 1132, 1213
TseI GCWGC 3 cut(s) 326, 878, 1174
Tsp45I GTSAC 2 cut(s) 1132, 1213
TspDTI ATGAA 3 cut(s) 75, 1187, 1191
TspRI CASTG 1 cut(s) 1216
XapI RAATTY 2 cut(s) 548, 704
XcmI CCANNNNNNNNNTGG 1 cut(s) 1234
XmiI GTMKAC 2 cut(s) 825, 989
XmnI GAANNNNTTC 3 cut(s) 835, 903, 1361
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.