Rmu_sc0000258.1_g000017

Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction alanine is first activated by ATP to form Ala- AMP and then transferred to the acceptor end of tRNA(Ala). Also edits incorrectly charged tRNA(Ala) via its editing domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000258.1
Physical Location & Seq
Forward (+)
80377 .. 80697
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000258.1_g000017.1.cds

Sequence Viewer

Length: 321 bp
atggatgatactgatgctgattcactaaaaaaagcagctgaatatctaatagatacgctacaggatctggcagctgtaattctgggctcttgtcctggtgatgagaaggtaagtttggttgcagcattcactccaggggttgtgaatttgggaatacaggcagggaagtttatagggcctatagctaagctgtgtggcgggggtgggggtggaagacccaattttgctcaggctggtgggaggaagcctgagaatttgtcagatgcacttgaaaaagctcgatctgaaatcttcttgcttctctctgaaaaggcaagctga

Protein Analysis

106

Amino Acids

10.86

Weight (kDa)

4.82

Isoelectric Point (pI)

33.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019781)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 198
AclWI GGATC 1 cut(s) 72
AcsI RAATTY 2 cut(s) 145, 253
AgsI TTSAA 1 cut(s) 272
AjnI CCWGG 2 cut(s) 94, 133
AjuI GAANNNNNNNTTGG 2 cut(s) 98, 130
AluBI AGCT 6 cut(s) 38, 74, 185, 190, 278, 318
AluI AGCT 6 cut(s) 38, 74, 185, 190, 278, 318
AlwI GGATC 1 cut(s) 72
AlwNI CAGNNNCTG 1 cut(s) 67
AoxI GGCC 1 cut(s) 176
ApeKI GCWGC 3 cut(s) 35, 71, 122
ApoI RAATTY 2 cut(s) 145, 253
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 110
BanII GRGCYC 1 cut(s) 89
BbsI GAAGAC 1 cut(s) 220
BbvI GCAGC 3 cut(s) 47, 83, 134
BciT130I CCWGG 2 cut(s) 96, 135
BfmI CTRYAG 2 cut(s) 59, 180
BisI GCNGC 3 cut(s) 36, 72, 123
BlpI GCTNAGC 1 cut(s) 186
BlsI GCNGC 3 cut(s) 37, 73, 124
Bme1390I CCNGG 2 cut(s) 96, 135
BmgT120I GGNCC 1 cut(s) 176
BmrFI CCNGG 2 cut(s) 96, 135
BmsI GCATC 2 cut(s) 4, 253
BpiI GAAGAC 1 cut(s) 220
BpmI CTGGAG 1 cut(s) 117
Bpu10I CCTNAGC 1 cut(s) 228
Bpu1102I GCTNAGC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 134
BseBI CCWGG 2 cut(s) 96, 135
BseDI CCNNGG 1 cut(s) 134
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 2 cut(s) 240, 242
BseXI GCAGC 3 cut(s) 47, 83, 134
BshFI GGCC 1 cut(s) 178
BsmI GAATGC 1 cut(s) 125
BsnI GGCC 1 cut(s) 178
Bsp1286I GDGCHC 1 cut(s) 89
Bsp143I GATC 2 cut(s) 64, 281
Bsp1720I GCTNAGC 1 cut(s) 186
BspACI CCGC 1 cut(s) 198
BspANI GGCC 1 cut(s) 178
BspCNI CTCAG 2 cut(s) 241, 241
BspPI GGATC 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 2 cut(s) 64, 281
Bst2UI CCWGG 2 cut(s) 96, 135
BstC8I GCNNGC 1 cut(s) 316
BstDEI CTNAG 3 cut(s) 186, 228, 249
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 67, 284
BstMBI GATC 2 cut(s) 64, 281
BstNI CCWGG 2 cut(s) 96, 135
BstSCI CCNGG 2 cut(s) 94, 133
BstSFI CTRYAG 2 cut(s) 59, 180
BstV1I GCAGC 3 cut(s) 47, 83, 134
BstV2I GAAGAC 1 cut(s) 220
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BsuRI GGCC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 316
CaiI CAGNNNCTG 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 176
DdeI CTNAG 3 cut(s) 186, 228, 249
DpnI GATC 2 cut(s) 66, 283
DpnII GATC 2 cut(s) 64, 281
Eco24I GRGCYC 1 cut(s) 89
EcoO109I RGGNCCY 1 cut(s) 176
EcoRII CCWGG 2 cut(s) 94, 133
EcoT38I GRGCYC 1 cut(s) 89
FaiI YATR 2 cut(s) 173, 182
FauI CCCGC 1 cut(s) 191
Fnu4HI GCNGC 3 cut(s) 36, 72, 123
FokI GGATG 1 cut(s) 17
FriOI GRGCYC 1 cut(s) 89
Fsp4HI GCNGC 3 cut(s) 36, 72, 123
GluI GCNGC 3 cut(s) 36, 72, 123
GsuI CTGGAG 1 cut(s) 117
HaeIII GGCC 1 cut(s) 178
HinfI GANTC 1 cut(s) 20
HphI GGTGA 1 cut(s) 110
Hpy188I TCNGA 3 cut(s) 262, 286, 307
HpyAV CCTTC 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 122, 266
HpyF3I CTNAG 3 cut(s) 186, 228, 249
Kzo9I GATC 2 cut(s) 64, 281
Lsp1109I GCAGC 3 cut(s) 47, 83, 134
LweI GCATC 2 cut(s) 4, 253
MalI GATC 2 cut(s) 66, 283
MboI GATC 2 cut(s) 64, 281
MboII GAAGA 2 cut(s) 225, 283
MflI RGATCY 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 89
MluCI AATT 4 cut(s) 78, 145, 220, 253
MnlI CCTC 1 cut(s) 234
MspA1I CMGCKG 2 cut(s) 38, 74
MspR9I CCNGG 2 cut(s) 96, 135
Mva1269I GAATGC 1 cut(s) 125
MvaI CCWGG 2 cut(s) 96, 135
NdeII GATC 2 cut(s) 64, 281
PctI GAATGC 1 cut(s) 125
PfeI GAWTC 1 cut(s) 20
PkrI GCNGC 3 cut(s) 37, 73, 124
Psp6I CCWGG 2 cut(s) 94, 133
PspGI CCWGG 2 cut(s) 94, 133
PspPI GGNCC 1 cut(s) 176
PstNI CAGNNNCTG 1 cut(s) 67
PsuI RGATCY 1 cut(s) 64
PvuII CAGCTG 2 cut(s) 38, 74
SatI GCNGC 3 cut(s) 36, 72, 123
Sau3AI GATC 2 cut(s) 64, 281
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 2 cut(s) 96, 135
SduI GDGCHC 1 cut(s) 89
SetI ASST 7 cut(s) 40, 76, 111, 187, 192, 280, 320
SfaNI GCATC 2 cut(s) 4, 253
SfcI CTRYAG 2 cut(s) 59, 180
Sse9I AATT 4 cut(s) 78, 145, 220, 253
SsiI CCGC 1 cut(s) 198
StyD4I CCNGG 2 cut(s) 94, 133
TaqI TCGA 1 cut(s) 280
TasI AATT 4 cut(s) 78, 145, 220, 253
TfiI GAWTC 1 cut(s) 20
TseI GCWGC 3 cut(s) 35, 71, 122
XapI RAATTY 2 cut(s) 145, 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.