Rmu_sc0000309.1_g000005

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000309.1
Physical Location & Seq
Forward (+)
26002 .. 27311
1310 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000309.1_g000005.1.cds

Sequence Viewer

Length: 1014 bp
atggtgcttttgtctaaaccagctactgaatactgctctagttatagcagaagcctcaagctctccaagtcatcctcctctggaatccctctcatagacctgtccaaaccagactccaaacaactcattgtcaaggcttgtgaggagtttggattcttcaaaatcatcaaccatggtgttcccatggatttcattaacagattggaatctgaggccatcaaattcttctccttgccagattctgagaaagaaaaagcagggcctgctgatccatttggatatggcagcaagcatatcgggagaaatggtgatgtggggtgggttgagtacctccttctcaaagccaatacagaagccaactctgacagattcaaatcagtttatggaacaaacccagatgagttttgttctgctctgaatgattacatacaagctgtgaggaatatggcttgtgagattcttgacctgatggctgaaggattgaatattgggccaaggaatgtgttcagtaagtttttgttggatgaacagagtgactctttattcaggctcaatcactacccaccatgcccagagcttcaaggcttgagtgaacatagtgacagaaatgtggttggatttggagagcacacagaccctcaaatcatttccatactaagatccaacaacacctctggcctccaaattttgggagatgggacttggatttcagtgcctccagaccagtactccttcttcatcaatgttggtgattctctaaaggttttgacaaatgggaggtttcaaagtgtgaggcacagggttttagcaaatgggtcaaaatcaagggtttcaatgattttctttgggggatcacccttgactgaaaaaatagctccattgccatctgtaatgaaagaagaggaacagagcatgtacaaagagttcacatggttcgaatacaaaacgatctgctaccactcaagattggctgacaataggctaggacactttgagagaattgaagcctcataa

Protein Analysis

337

Amino Acids

37.81

Weight (kDa)

5.81

Isoelectric Point (pI)

43.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012870)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 688
AclWI GGATC 3 cut(s) 263, 654, 859
AcsI RAATTY 2 cut(s) 221, 684
AcuI CTGAAG 1 cut(s) 495
AfaI GTAC 3 cut(s) 329, 728, 917
AfiI CCNNNNNNNGG 1 cut(s) 688
AgsI TTSAA 7 cut(s) 160, 373, 484, 581, 785, 834, 1004
AluBI AGCT 5 cut(s) 23, 61, 434, 577, 875
AluI AGCT 5 cut(s) 23, 61, 434, 577, 875
Alw21I GWGCWC 1 cut(s) 630
AlwI GGATC 3 cut(s) 263, 654, 859
AlwNI CAGNNNCTG 3 cut(s) 26, 242, 263
AoxI GGCC 4 cut(s) 213, 260, 491, 676
ApeKI GCWGC 1 cut(s) 285
ApoI RAATTY 2 cut(s) 221, 684
Asp700I GAANNNNTTC 1 cut(s) 503
AspS9I GGNCC 2 cut(s) 260, 491
AsuHPI GGTGA 3 cut(s) 320, 761, 846
AsuII TTCGAA 1 cut(s) 936
BarI GAAGNNNNNNTAC 2 cut(s) 719, 751
Bbv12I GWGCWC 1 cut(s) 630
BbvI GCAGC 1 cut(s) 297
BccI CCATC 4 cut(s) 224, 463, 689, 892
BcgI CGANNNNNNTGC 2 cut(s) 277, 311
BfaI CTAG 2 cut(s) 39, 983
BisI GCNGC 1 cut(s) 286
BlsI GCNGC 1 cut(s) 287
BmcAI AGTACT 1 cut(s) 728
BmgT120I GGNCC 2 cut(s) 260, 491
BpmI CTGGAG 1 cut(s) 702
Bpu14I TTCGAA 1 cut(s) 936
BpuEI CTTGAG 3 cut(s) 41, 607, 946
BsaBI GATNNNNATC 2 cut(s) 205, 373
BsaJI CCNNGG 3 cut(s) 172, 183, 494
BsaXI ACNNNNNCTCC 4 cut(s) 292, 322, 713, 743
Bsc4I CCNNNNNNNGG 1 cut(s) 688
Bse1I ACTGG 1 cut(s) 724
Bse3DI GCAATG 1 cut(s) 878
Bse8I GATNNNNATC 2 cut(s) 205, 373
BseDI CCNNGG 3 cut(s) 172, 183, 494
BseGI GGATG 2 cut(s) 71, 529
BseJI GATNNNNATC 2 cut(s) 205, 373
BseLI CCNNNNNNNGG 1 cut(s) 688
BseMI GCAATG 1 cut(s) 878
BseMII CTCAG 2 cut(s) 201, 234
BseNI ACTGG 1 cut(s) 724
BseRI GAGGAG 2 cut(s) 67, 158
BseXI GCAGC 1 cut(s) 297
BshFI GGCC 4 cut(s) 215, 262, 493, 678
BsiHKAI GWGCWC 1 cut(s) 630
BslFI GGGAC 1 cut(s) 712
BslI CCNNNNNNNGG 1 cut(s) 688
BsmFI GGGAC 1 cut(s) 712
BsnI GGCC 4 cut(s) 215, 262, 493, 678
Bsp119I TTCGAA 1 cut(s) 936
Bsp1286I GDGCHC 1 cut(s) 630
Bsp1407I TGTACA 1 cut(s) 915
Bsp143I GATC 4 cut(s) 268, 659, 851, 948
Bsp19I CCATGG 2 cut(s) 172, 183
BspANI GGCC 4 cut(s) 215, 262, 493, 678
BspCNI CTCAG 2 cut(s) 202, 235
BspPI GGATC 3 cut(s) 263, 654, 859
BspT104I TTCGAA 1 cut(s) 936
BsrDI GCAATG 1 cut(s) 878
BsrGI TGTACA 1 cut(s) 915
BsrI ACTGG 1 cut(s) 724
BssECI CCNNGG 3 cut(s) 172, 183, 494
BssMI GATC 4 cut(s) 268, 659, 851, 948
BssT1I CCWWGG 3 cut(s) 172, 183, 494
Bst6I CTCTTC 1 cut(s) 894
BstAPI GCANNNNNTGC 1 cut(s) 263
BstAUI TGTACA 1 cut(s) 915
BstBI TTCGAA 1 cut(s) 936
BstC8I GCNNGC 2 cut(s) 264, 290
BstDEI CTNAG 3 cut(s) 210, 243, 656
BstDSI CCRYGG 2 cut(s) 172, 183
BstF5I GGATG 2 cut(s) 71, 529
BstKTI GATC 4 cut(s) 271, 662, 854, 951
BstMBI GATC 4 cut(s) 268, 659, 851, 948
BstMWI GCNNNNNNNGC 1 cut(s) 263
BstNSI RCATGY 1 cut(s) 916
BstV1I GCAGC 1 cut(s) 297
BstX2I RGATCY 1 cut(s) 659
BstYI RGATCY 1 cut(s) 659
BsuRI GGCC 4 cut(s) 215, 262, 493, 678
BtgI CCRYGG 2 cut(s) 172, 183
BtsCI GGATG 2 cut(s) 71, 529
BtsIMutI CAGTG 1 cut(s) 717
Cac8I GCNNGC 2 cut(s) 264, 290
CaiI CAGNNNCTG 3 cut(s) 26, 242, 263
Cfr13I GGNCC 2 cut(s) 260, 491
Csp6I GTAC 3 cut(s) 328, 727, 916
CviAII CATG 5 cut(s) 173, 184, 567, 913, 930
CviQI GTAC 3 cut(s) 328, 727, 916
DdeI CTNAG 3 cut(s) 210, 243, 656
DpnI GATC 4 cut(s) 270, 661, 853, 950
DpnII GATC 4 cut(s) 268, 659, 851, 948
Eam1104I CTCTTC 1 cut(s) 894
EarI CTCTTC 1 cut(s) 894
Eco130I CCWWGG 3 cut(s) 172, 183, 494
Eco57I CTGAAG 1 cut(s) 495
EcoO109I RGGNCCY 1 cut(s) 260
EcoT14I CCWWGG 3 cut(s) 172, 183, 494
ErhI CCWWGG 3 cut(s) 172, 183, 494
FaeI CATG 5 cut(s) 176, 187, 570, 916, 933
FaqI GGGAC 1 cut(s) 712
FatI CATG 5 cut(s) 172, 183, 566, 912, 929
Fnu4HI GCNGC 1 cut(s) 286
FokI GGATG 2 cut(s) 58, 536
Fsp4HI GCNGC 1 cut(s) 286
FspBI CTAG 2 cut(s) 39, 983
GluI GCNGC 1 cut(s) 286
GsuI CTGGAG 1 cut(s) 702
HaeIII GGCC 4 cut(s) 215, 262, 493, 678
Hin1II CATG 5 cut(s) 176, 187, 570, 916, 933
HinfI GANTC 9 cut(s) 84, 113, 153, 206, 239, 369, 457, 536, 752
HphI GGTGA 3 cut(s) 320, 761, 846
Hpy166II GTNNAC 2 cut(s) 593, 927
Hpy188I TCNGA 4 cut(s) 211, 244, 364, 417
Hpy188III TCNNGA 5 cut(s) 81, 298, 461, 719, 963
Hpy8I GTNNAC 2 cut(s) 593, 927
HpyAV CCTTC 3 cut(s) 344, 470, 742
HpyF10VI GCNNNNNNNGC 1 cut(s) 263
HpyF3I CTNAG 3 cut(s) 210, 243, 656
Hsp92II CATG 5 cut(s) 176, 187, 570, 916, 933
Kzo9I GATC 4 cut(s) 268, 659, 851, 948
LmnI GCTCC 1 cut(s) 880
Lsp1109I GCAGC 1 cut(s) 297
MaeI CTAG 2 cut(s) 39, 983
MaeIII GTNAC 2 cut(s) 533, 599
MalI GATC 4 cut(s) 270, 661, 853, 950
MboI GATC 4 cut(s) 268, 659, 851, 948
MboII GAAGA 4 cut(s) 148, 217, 727, 911
MflI RGATCY 1 cut(s) 659
MhlI GDGCHC 1 cut(s) 630
MluCI AATT 3 cut(s) 221, 684, 999
MlyI GAGTC 2 cut(s) 107, 530
MmeI TCCRAC 3 cut(s) 501, 595, 687
MroXI GAANNNNTTC 1 cut(s) 503
MseI TTAA 1 cut(s) 195
MwoI GCNNNNNNNGC 1 cut(s) 263
NcoI CCATGG 2 cut(s) 172, 183
NdeII GATC 4 cut(s) 268, 659, 851, 948
NlaIII CATG 5 cut(s) 176, 187, 570, 916, 933
NmuCI GTSAC 2 cut(s) 533, 599
NspI RCATGY 1 cut(s) 916
NspV TTCGAA 1 cut(s) 936
PdmI GAANNNNTTC 1 cut(s) 503
PfeI GAWTC 7 cut(s) 84, 153, 206, 239, 369, 457, 752
PflMI CCANNNNNTGG 1 cut(s) 688
PkrI GCNGC 1 cut(s) 287
PleI GAGTC 2 cut(s) 107, 530
PpsI GAGTC 2 cut(s) 107, 530
PspPI GGNCC 2 cut(s) 260, 491
PsrI GAACNNNNNNTAC 2 cut(s) 908, 940
PstNI CAGNNNCTG 3 cut(s) 26, 242, 263
PsuI RGATCY 1 cut(s) 659
RsaI GTAC 3 cut(s) 329, 728, 917
RsaNI GTAC 3 cut(s) 328, 727, 916
SaqAI TTAA 1 cut(s) 195
SatI GCNGC 1 cut(s) 286
Sau3AI GATC 4 cut(s) 268, 659, 851, 948
Sau96I GGNCC 2 cut(s) 260, 491
ScaI AGTACT 1 cut(s) 728
SchI GAGTC 2 cut(s) 107, 530
SduI GDGCHC 1 cut(s) 630
SfuI TTCGAA 1 cut(s) 936
SmlI CTYRAG 3 cut(s) 56, 586, 961
SmoI CTYRAG 3 cut(s) 56, 586, 961
Sse9I AATT 3 cut(s) 221, 684, 999
SspI AATATT 1 cut(s) 487
SspMI CTAG 2 cut(s) 39, 983
StyI CCWWGG 3 cut(s) 172, 183, 494
TaqI TCGA 1 cut(s) 936
TasI AATT 3 cut(s) 221, 684, 999
TatI WGTACW 2 cut(s) 726, 915
TfiI GAWTC 7 cut(s) 84, 153, 206, 239, 369, 457, 752
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TscAI CASTG 1 cut(s) 717
TseFI GTSAC 2 cut(s) 533, 599
TseI GCWGC 1 cut(s) 285
Tsp45I GTSAC 2 cut(s) 533, 599
TspDTI ATGAA 4 cut(s) 181, 540, 727, 908
TspRI CASTG 1 cut(s) 717
Van91I CCANNNNNTGG 1 cut(s) 688
XapI RAATTY 2 cut(s) 221, 684
XceI RCATGY 1 cut(s) 916
XmnI GAANNNNTTC 1 cut(s) 503
XspI CTAG 2 cut(s) 39, 983
ZrmI AGTACT 1 cut(s) 728
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.