Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000369.1

Orthogroup ID

OG0018630

Physical Location & Seq

Genomic Coordinates Reverse (-)

75150 .. 79192

Gene Structure 4043 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 750 bp

atgaacgaaacaatggtggagaatgtagtgtctgtagtcaaggtcacctcttggatggatacagaagtcgacggcgaaggagaaatactagcaatcacgactttgatattgtactcaagtaaggcacttcttcctctagcacatcttcgtcatcatccttcagacgaagaggatccttttcaggatcaagtctacggacgatcatgcactatgccaataatgccttcagacgacacatttcagacgacagaatttttccaatctctccctcgctcgcacgctcgatctcactctcatgaacctcagtccctcaatccctttcaccctctcaagctcacacacactctcatcctcctgcgattccggcaaagcaagtttgggtatggaagttttgggtatagaagtttgggtaaagtaagtttgcaaagcatagacgtcctcaagtttggttcgatttctggttcgatttcgaattcttcaagcttgggatctatcaaagaatcaactgactggctcattaccagacttggggagcttgcgaaaccttcggtatctggtattccggagcaaaaaaatgacaagacttgtggatatttcattatgcgttacatgaaagaaattgtggaggacaagaacttggattttagtatgaagtggggaacgaggtcaaatttggtttacacagtcaatgatattgatgagatccgagcggaatgggctgagcatgttttgaagttcccagaaaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_C48 Transposase_24

Protein Analysis

249

Amino Acids

28.25

Weight (kDa)

5.72

Isoelectric Point (pI)

47.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018630)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0307081
rosa_multiflora	Rmu_sc0000369.1_g000017 Rmu_sc0002541.1_g000010 Rmu_sc0009812.1_g000004 Rmu_sc0010906.1_g000003 Rmu_ssc0000322.1_g000012
rosa_roxburghii	Rroxscaffold_178G00437380 Rroxscaffold_5G00361640 Rroxscaffold_7G00205550
rosa_samantha	Rh7DG397600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	438
AccBSI	CCGCTC	1 cut(s)	710
AccI	GTMKAC	2 cut(s)	69, 192
AccIII	TCCGGA	1 cut(s)	562
AciI	CCGC	1 cut(s)	710
AclWI	GGATC	5 cut(s)	167, 180, 192, 496, 697
AcsI	RAATTY	3 cut(s)	251, 472, 670
AcuI	CTGAAG	2 cut(s)	144, 210
AcyI	GRCGYC	1 cut(s)	435
AfaI	GTAC	1 cut(s)	113
AfiI	CCNNNNNNNGG	1 cut(s)	528
AgsI	TTSAA	2 cut(s)	480, 733
AjuI	GAANNNNNNNTTGG	2 cut(s)	208, 240
AluBI	AGCT	3 cut(s)	334, 483, 535
AluI	AGCT	3 cut(s)	334, 483, 535
AlwI	GGATC	5 cut(s)	167, 180, 192, 496, 697
Aor13HI	TCCGGA	1 cut(s)	562
ApoI	RAATTY	3 cut(s)	251, 472, 670
AsuHPI	GGTGA	2 cut(s)	37, 314
AsuII	TTCGAA	1 cut(s)	470
BaeI	ACNNNNGTAYC	2 cut(s)	51, 84
BamHI	GGATCC	1 cut(s)	172
BarI	GAAGNNNNNNTAC	2 cut(s)	69, 101
BccI	CCATC	1 cut(s)	49
BceAI	ACGGC	1 cut(s)	88
BciVI	GTATCC	1 cut(s)	52
BfaI	CTAG	2 cut(s)	89, 137
BfmI	CTRYAG	1 cut(s)	33
BfuI	GTATCC	1 cut(s)	52
BlpI	GCTNAGC	1 cut(s)	720
BmiI	GGNNCC	1 cut(s)	174
Bpu1102I	GCTNAGC	1 cut(s)	720
Bpu14I	TTCGAA	1 cut(s)	470
BpuEI	CTTGAG	3 cut(s)	100, 314, 425
BsaHI	GRCGYC	1 cut(s)	435
BsaWI	WCCGGW	1 cut(s)	562
Bsc4I	CCNNNNNNNGG	1 cut(s)	528
Bse1I	ACTGG	1 cut(s)	515
BseAI	TCCGGA	1 cut(s)	562
BseGI	GGATG	3 cut(s)	60, 154, 348
BseLI	CCNNNNNNNGG	1 cut(s)	528
BseMII	CTCAG	2 cut(s)	317, 711
BseNI	ACTGG	1 cut(s)	515
BsiSI	CCGG	2 cut(s)	364, 563
BslFI	GGGAC	1 cut(s)	292
BslI	CCNNNNNNNGG	1 cut(s)	528
BsmFI	GGGAC	1 cut(s)	292
Bsp119I	TTCGAA	1 cut(s)	470
Bsp13I	TCCGGA	1 cut(s)	562
Bsp143I	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
Bsp1720I	GCTNAGC	1 cut(s)	720
BspACI	CCGC	1 cut(s)	710
BspCNI	CTCAG	2 cut(s)	316, 712
BspEI	TCCGGA	1 cut(s)	562
BspHI	TCATGA	1 cut(s)	295
BspLI	GGNNCC	1 cut(s)	174
BspPI	GGATC	5 cut(s)	167, 180, 192, 496, 697
BspT104I	TTCGAA	1 cut(s)	470
BsrBI	CCGCTC	1 cut(s)	710
BsrI	ACTGG	1 cut(s)	515
BssMI	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
BssNI	GRCGYC	1 cut(s)	435
Bst4CI	ACNGT	1 cut(s)	685
Bst6I	CTCTTC	1 cut(s)	162
BstACI	GRCGYC	1 cut(s)	435
BstBI	TTCGAA	1 cut(s)	470
BstC8I	GCNNGC	3 cut(s)	275, 279, 537
BstDEI	CTNAG	2 cut(s)	303, 720
BstEII	GGTNACC	1 cut(s)	43
BstF5I	GGATG	3 cut(s)	60, 154, 348
BstKTI	GATC	6 cut(s)	175, 187, 203, 287, 491, 705
BstMBI	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
BstMWI	GCNNNNNNNGC	3 cut(s)	220, 364, 716
BstNSI	RCATGY	1 cut(s)	728
BstPI	GGTNACC	1 cut(s)	43
BstSFI	CTRYAG	1 cut(s)	33
BstX2I	RGATCY	3 cut(s)	172, 488, 702
BstYI	RGATCY	3 cut(s)	172, 488, 702
BsuI	GTATCC	1 cut(s)	52
BtsCI	GGATG	3 cut(s)	60, 154, 348
Cac8I	GCNNGC	3 cut(s)	275, 279, 537
CciI	TCATGA	1 cut(s)	295
Csp6I	GTAC	1 cut(s)	112
CspCI	CAANNNNNGTGG	2 cut(s)	568, 603
CviAII	CATG	4 cut(s)	204, 296, 610, 725
CviJI	RGCY	5 cut(s)	334, 483, 514, 535, 719
CviKI_1	RGCY	5 cut(s)	334, 483, 514, 535, 719
CviQI	GTAC	1 cut(s)	112
DdeI	CTNAG	2 cut(s)	303, 720
DpnI	GATC	6 cut(s)	174, 186, 202, 286, 490, 704
DpnII	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
Eam1104I	CTCTTC	1 cut(s)	162
EarI	CTCTTC	1 cut(s)	162
Eco57I	CTGAAG	2 cut(s)	144, 210
Eco91I	GGTNACC	1 cut(s)	43
EcoO65I	GGTNACC	1 cut(s)	43
EcoRI	GAATTC	1 cut(s)	472
FaeI	CATG	4 cut(s)	207, 299, 613, 728
FaqI	GGGAC	1 cut(s)	292
FatI	CATG	4 cut(s)	203, 295, 609, 724
FblI	GTMKAC	2 cut(s)	69, 192
FokI	GGATG	3 cut(s)	67, 141, 335
FspBI	CTAG	2 cut(s)	89, 137
HapII	CCGG	2 cut(s)	364, 563
Hin1I	GRCGYC	1 cut(s)	435
Hin1II	CATG	4 cut(s)	207, 299, 613, 728
HincII	GTYRAC	1 cut(s)	70
HindII	GTYRAC	1 cut(s)	70
HindIII	AAGCTT	1 cut(s)	481
HinfI	GANTC	2 cut(s)	360, 500
HpaII	CCGG	2 cut(s)	364, 563
HphI	GGTGA	2 cut(s)	37, 314
Hpy166II	GTNNAC	3 cut(s)	70, 193, 679
Hpy188I	TCNGA	4 cut(s)	163, 229, 243, 707
Hpy188III	TCNNGA	4 cut(s)	97, 182, 296, 563
Hpy8I	GTNNAC	3 cut(s)	70, 193, 679
Hpy99I	CGWCG	1 cut(s)	74
HpyAV	CCTTC	4 cut(s)	71, 168, 234, 555
HpyCH4III	ACNGT	1 cut(s)	685
HpyCH4IV	ACGT	1 cut(s)	435
HpyCH4V	TGCA	2 cut(s)	207, 424
HpyF10VI	GCNNNNNNNGC	3 cut(s)	220, 364, 716
HpyF3I	CTNAG	2 cut(s)	303, 720
HpySE526I	ACGT	1 cut(s)	435
Hsp92I	GRCGYC	1 cut(s)	435
Hsp92II	CATG	4 cut(s)	207, 299, 613, 728
Kpn2I	TCCGGA	1 cut(s)	562
Kzo9I	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
LmnI	GCTCC	2 cut(s)	532, 565
LpnPI	CCDG	8 cut(s)	167, 368, 377, 444, 496, 535, 540, 576
MaeI	CTAG	2 cut(s)	89, 137
MaeII	ACGT	1 cut(s)	435
MaeIII	GTNAC	2 cut(s)	43, 605
MalI	GATC	6 cut(s)	174, 186, 202, 286, 490, 704
MbiI	CCGCTC	1 cut(s)	710
MboI	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
MboII	GAAGA	4 cut(s)	122, 137, 179, 468
MflI	RGATCY	3 cut(s)	172, 488, 702
MluCI	AATT	5 cut(s)	251, 472, 618, 670, 745
MroI	TCCGGA	1 cut(s)	562
MseI	TTAA	1 cut(s)	748
MslI	CAYNNNNRTG	1 cut(s)	294
MspI	CCGG	2 cut(s)	364, 563
MwoI	GCNNNNNNNGC	3 cut(s)	220, 364, 716
NdeII	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
NlaIII	CATG	4 cut(s)	207, 299, 613, 728
NlaIV	GGNNCC	1 cut(s)	174
NmuCI	GTSAC	1 cut(s)	43
NspI	RCATGY	1 cut(s)	728
NspV	TTCGAA	1 cut(s)	470
PagI	TCATGA	1 cut(s)	295
PfeI	GAWTC	2 cut(s)	360, 500
PspEI	GGTNACC	1 cut(s)	43
PspN4I	GGNNCC	1 cut(s)	174
PsuI	RGATCY	3 cut(s)	172, 488, 702
RsaI	GTAC	1 cut(s)	113
RsaNI	GTAC	1 cut(s)	112
RseI	CAYNNNNRTG	1 cut(s)	294
SalI	GTCGAC	1 cut(s)	68
SaqAI	TTAA	1 cut(s)	748
Sau3AI	GATC	6 cut(s)	172, 184, 200, 284, 488, 702
SetI	ASST	9 cut(s)	45, 50, 304, 336, 438, 485, 537, 547, 668
SfcI	CTRYAG	1 cut(s)	33
SfuI	TTCGAA	1 cut(s)	470
SmiMI	CAYNNNNRTG	1 cut(s)	294
SmlI	CTYRAG	3 cut(s)	115, 329, 440
SmoI	CTYRAG	3 cut(s)	115, 329, 440
Sse9I	AATT	5 cut(s)	251, 472, 618, 670, 745
SsiI	CCGC	1 cut(s)	710
SspMI	CTAG	2 cut(s)	89, 137
TaaI	ACNGT	1 cut(s)	685
TaiI	ACGT	1 cut(s)	438
TaqI	TCGA	5 cut(s)	69, 283, 452, 464, 470
TasI	AATT	5 cut(s)	251, 472, 618, 670, 745
TatI	WGTACW	1 cut(s)	111
TfiI	GAWTC	2 cut(s)	360, 500
Tru1I	TTAA	1 cut(s)	748
Tru9I	TTAA	1 cut(s)	748
TseFI	GTSAC	1 cut(s)	43
Tsp45I	GTSAC	1 cut(s)	43
TspDTI	ATGAA	5 cut(s)	17, 312, 586, 626, 665
TspGWI	ACGGA	1 cut(s)	210
XapI	RAATTY	3 cut(s)	251, 472, 670
XceI	RCATGY	1 cut(s)	728
XmiI	GTMKAC	2 cut(s)	69, 192
XspI	CTAG	2 cut(s)	89, 137
ZraI	GACGTC	1 cut(s)	436

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.