Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000322.1

Orthogroup ID

OG0018630

Physical Location & Seq

Genomic Coordinates Reverse (-)

47832 .. 49134

Gene Structure 1303 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000322.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 558 bp

ctgcgattccggcaaagcaagtttgggtatggaagttttgggtatagaagtttgggtaaagtaagtttgcaaagcatagacgtcctcaagtttggttcgatttctggttcgatttcgaattcttcaagcttgggatctatcaaagaatcaactgactggctcattaccagacttggggagcttgcgaaaccttcggtatcttacaacttgctggaaggcgctataccaccaaccttgggttcactagtgaatcttcggcaactgtatctctacttcaataggttatcaggctcaattcctgatgaattgggaaatctcagcaatcttactacattggatatttctgagaaccagctcactggtccgcttcccaaaacacttggaaatttgaaatccctcagcggcttctgggccacagccaattccttgaatgataaatttccggacacttatgggaaccttacgagtctaaaatatttttcaatatccgggaattatatctctggtccattcccagttgacatcataaagaactggactaatattgaaactctgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

185

Amino Acids

20.2

Weight (kDa)

9.1

Isoelectric Point (pI)

23.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018630)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0307081
rosa_multiflora	Rmu_sc0000369.1_g000017 Rmu_sc0002541.1_g000010 Rmu_sc0009812.1_g000004 Rmu_sc0010906.1_g000003 Rmu_ssc0000322.1_g000012
rosa_roxburghii	Rroxscaffold_178G00437380 Rroxscaffold_5G00361640 Rroxscaffold_7G00205550
rosa_samantha	Rh7DG397600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	84
AccIII	TCCGGA	1 cut(s)	442
AciI	CCGC	2 cut(s)	365, 402
AclWI	GGATC	1 cut(s)	142
AcsI	RAATTY	3 cut(s)	118, 385, 437
AcyI	GRCGYC	1 cut(s)	81
AfiI	CCNNNNNNNGG	2 cut(s)	174, 236
AgsI	TTSAA	6 cut(s)	126, 277, 391, 430, 483, 548
AhlI	ACTAGT	1 cut(s)	244
AjuI	GAANNNNNNNTTGG	2 cut(s)	223, 255
AluBI	AGCT	3 cut(s)	129, 181, 355
AluI	AGCT	3 cut(s)	129, 181, 355
AlwI	GGATC	1 cut(s)	142
Aor13HI	TCCGGA	1 cut(s)	442
AoxI	GGCC	1 cut(s)	411
ApoI	RAATTY	3 cut(s)	118, 385, 437
AspLEI	GCGC	1 cut(s)	221
AspS9I	GGNCC	3 cut(s)	362, 411, 506
AsuC2I	CCSGG	1 cut(s)	490
AsuII	TTCGAA	1 cut(s)	116
AvaII	GGWCC	2 cut(s)	362, 506
BarI	GAAGNNNNNNTAC	4 cut(s)	207, 239, 257, 289
BbvCI	CCTCAGC	1 cut(s)	398
BcnI	CCSGG	1 cut(s)	490
BcuI	ACTAGT	1 cut(s)	244
BfaI	CTAG	1 cut(s)	245
BfoI	RGCGCY	1 cut(s)	222
BisI	GCNGC	1 cut(s)	403
BlsI	GCNGC	1 cut(s)	404
Bme1390I	CCNGG	1 cut(s)	490
Bme18I	GGWCC	2 cut(s)	362, 506
BmgT120I	GGNCC	3 cut(s)	362, 411, 506
BmiI	GGNNCC	1 cut(s)	458
BmrFI	CCNGG	1 cut(s)	490
BmrI	ACTGGG	1 cut(s)	509
BmuI	ACTGGG	1 cut(s)	509
Bpu10I	CCTNAGC	1 cut(s)	398
Bpu14I	TTCGAA	1 cut(s)	116
BpuEI	CTTGAG	1 cut(s)	71
BpuMI	CCSGG	1 cut(s)	490
BsaHI	GRCGYC	1 cut(s)	81
BsaJI	CCNNGG	1 cut(s)	234
BsaWI	WCCGGW	1 cut(s)	442
Bsc4I	CCNNNNNNNGG	2 cut(s)	174, 236
Bse1I	ACTGG	4 cut(s)	161, 364, 515, 539
BseAI	TCCGGA	1 cut(s)	442
BseDI	CCNNGG	1 cut(s)	234
BseLI	CCNNNNNNNGG	2 cut(s)	174, 236
BseMII	CTCAG	3 cut(s)	331, 336, 412
BseNI	ACTGG	4 cut(s)	161, 364, 515, 539
BshFI	GGCC	1 cut(s)	413
BsiSI	CCGG	3 cut(s)	10, 443, 489
BslI	CCNNNNNNNGG	2 cut(s)	174, 236
BsnI	GGCC	1 cut(s)	413
Bsp119I	TTCGAA	1 cut(s)	116
Bsp13I	TCCGGA	1 cut(s)	442
Bsp143I	GATC	1 cut(s)	134
BspACI	CCGC	2 cut(s)	365, 402
BspANI	GGCC	1 cut(s)	413
BspCNI	CTCAG	3 cut(s)	330, 337, 411
BspEI	TCCGGA	1 cut(s)	442
BspLI	GGNNCC	1 cut(s)	458
BspPI	GGATC	1 cut(s)	142
BspT104I	TTCGAA	1 cut(s)	116
BsrI	ACTGG	4 cut(s)	161, 364, 515, 539
BssECI	CCNNGG	1 cut(s)	234
BssMI	GATC	1 cut(s)	134
BssNI	GRCGYC	1 cut(s)	81
BssT1I	CCWWGG	1 cut(s)	234
Bst4CI	ACNGT	1 cut(s)	264
BstACI	GRCGYC	1 cut(s)	81
BstBI	TTCGAA	1 cut(s)	116
BstC8I	GCNNGC	1 cut(s)	183
BstDEI	CTNAG	3 cut(s)	317, 345, 398
BstH2I	RGCGCY	1 cut(s)	222
BstHHI	GCGC	1 cut(s)	221
BstKTI	GATC	1 cut(s)	137
BstMBI	GATC	1 cut(s)	134
BstMWI	GCNNNNNNNGC	1 cut(s)	10
BstSCI	CCNGG	1 cut(s)	488
BstX2I	RGATCY	1 cut(s)	134
BstXI	CCANNNNNNTGG	1 cut(s)	359
BstYI	RGATCY	1 cut(s)	134
BsuRI	GGCC	1 cut(s)	413
BtsIMutI	CAGTG	1 cut(s)	357
Cac8I	GCNNGC	1 cut(s)	183
CfoI	GCGC	1 cut(s)	221
Cfr13I	GGNCC	3 cut(s)	362, 411, 506
CspCI	CAANNNNNGTGG	2 cut(s)	216, 251
CviJI	RGCY	8 cut(s)	129, 160, 181, 291, 355, 405, 413, 419
CviKI_1	RGCY	8 cut(s)	129, 160, 181, 291, 355, 405, 413, 419
DdeI	CTNAG	3 cut(s)	317, 345, 398
DpnI	GATC	1 cut(s)	136
DpnII	GATC	1 cut(s)	134
Eco130I	CCWWGG	1 cut(s)	234
Eco47I	GGWCC	2 cut(s)	362, 506
EcoRI	GAATTC	1 cut(s)	118
EcoT14I	CCWWGG	1 cut(s)	234
ErhI	CCWWGG	1 cut(s)	234
FaiI	YATR	7 cut(s)	30, 45, 77, 224, 453, 498, 527
Fnu4HI	GCNGC	1 cut(s)	403
Fsp4HI	GCNGC	1 cut(s)	403
FspBI	CTAG	1 cut(s)	245
GlaI	GCGC	1 cut(s)	220
GluI	GCNGC	1 cut(s)	403
HaeII	RGCGCY	1 cut(s)	222
HaeIII	GGCC	1 cut(s)	413
HapII	CCGG	3 cut(s)	10, 443, 489
HhaI	GCGC	1 cut(s)	221
Hin1I	GRCGYC	1 cut(s)	81
Hin6I	GCGC	1 cut(s)	219
HinP1I	GCGC	1 cut(s)	219
HincII	GTYRAC	1 cut(s)	520
HindII	GTYRAC	1 cut(s)	520
HindIII	AAGCTT	1 cut(s)	127
HinfI	GANTC	4 cut(s)	6, 146, 250, 466
HpaII	CCGG	3 cut(s)	10, 443, 489
Hpy166II	GTNNAC	2 cut(s)	242, 520
Hpy188I	TCNGA	1 cut(s)	346
Hpy188III	TCNNGA	2 cut(s)	299, 443
Hpy8I	GTNNAC	2 cut(s)	242, 520
HpyAV	CCTTC	2 cut(s)	201, 209
HpyCH4III	ACNGT	1 cut(s)	264
HpyCH4IV	ACGT	1 cut(s)	81
HpyCH4V	TGCA	1 cut(s)	70
HpyF10VI	GCNNNNNNNGC	1 cut(s)	10
HpyF3I	CTNAG	3 cut(s)	317, 345, 398
HpySE526I	ACGT	1 cut(s)	81
Hsp92I	GRCGYC	1 cut(s)	81
HspAI	GCGC	1 cut(s)	219
Kpn2I	TCCGGA	1 cut(s)	442
Kzo9I	GATC	1 cut(s)	134
LmnI	GCTCC	1 cut(s)	178
MaeI	CTAG	1 cut(s)	245
MaeII	ACGT	1 cut(s)	81
MalI	GATC	1 cut(s)	136
MboI	GATC	1 cut(s)	134
MboII	GAAGA	2 cut(s)	114, 245
MflI	RGATCY	1 cut(s)	134
MluCI	AATT	7 cut(s)	118, 294, 305, 385, 421, 437, 493
MlyI	GAGTC	1 cut(s)	475
MnlI	CCTC	2 cut(s)	95, 407
MroI	TCCGGA	1 cut(s)	442
MspA1I	CMGCKG	1 cut(s)	402
MspI	CCGG	3 cut(s)	10, 443, 489
MspR9I	CCNGG	1 cut(s)	490
MwoI	GCNNNNNNNGC	1 cut(s)	10
NciI	CCSGG	1 cut(s)	490
NdeII	GATC	1 cut(s)	134
NlaIV	GGNNCC	1 cut(s)	458
NspV	TTCGAA	1 cut(s)	116
PfeI	GAWTC	3 cut(s)	6, 146, 250
PfoI	TCCNGGA	1 cut(s)	488
PkrI	GCNGC	1 cut(s)	404
PleI	GAGTC	1 cut(s)	474
PpsI	GAGTC	1 cut(s)	474
PspN4I	GGNNCC	1 cut(s)	458
PspPI	GGNCC	3 cut(s)	362, 411, 506
PsuI	RGATCY	1 cut(s)	134
SatI	GCNGC	1 cut(s)	403
Sau3AI	GATC	1 cut(s)	134
Sau96I	GGNCC	3 cut(s)	362, 411, 506
SchI	GAGTC	1 cut(s)	475
ScrFI	CCNGG	1 cut(s)	490
SetI	ASST	8 cut(s)	84, 131, 183, 193, 236, 284, 357, 462
SfuI	TTCGAA	1 cut(s)	116
SinI	GGWCC	2 cut(s)	362, 506
SmlI	CTYRAG	1 cut(s)	86
SmoI	CTYRAG	1 cut(s)	86
SpeI	ACTAGT	1 cut(s)	244
Sse9I	AATT	7 cut(s)	118, 294, 305, 385, 421, 437, 493
SsiI	CCGC	2 cut(s)	365, 402
SspI	AATATT	2 cut(s)	476, 544
SspMI	CTAG	1 cut(s)	245
StyD4I	CCNGG	1 cut(s)	488
StyI	CCWWGG	1 cut(s)	234
TaaI	ACNGT	1 cut(s)	264
TaiI	ACGT	1 cut(s)	84
TaqI	TCGA	3 cut(s)	98, 110, 116
TasI	AATT	7 cut(s)	118, 294, 305, 385, 421, 437, 493
TauI	GCSGC	1 cut(s)	405
TfiI	GAWTC	3 cut(s)	6, 146, 250
TscAI	CASTG	1 cut(s)	364
TspDTI	ATGAA	1 cut(s)	318
TspRI	CASTG	1 cut(s)	364
VpaK11BI	GGWCC	2 cut(s)	362, 506
XapI	RAATTY	3 cut(s)	118, 385, 437
XspI	CTAG	1 cut(s)	245
ZraI	GACGTC	1 cut(s)	82

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.