Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000546.1

Orthogroup ID

OG0018007

Physical Location & Seq

Genomic Coordinates Reverse (-)

303320 .. 303649

Gene Structure 330 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000546.1_g000064.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

atggctattggtgactttaattccattttgggtgcacatgattttataggtgggcaggttcctaatcagtcttcatgtgaggatttccacagtgccatggatctctataacttcactcacttagacacagcaggtgctttcttcacttggtccaaaactttgtttggtggccacatggaacgtgagttagatcgtactttatgtgatggtcaatggttggattcttggtctcacactagttgcatggctcttcctctggccatctttgatcataattgtctggtcttcacggcaggcagtgctccatccaatggtccaaaacctttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

109

Amino Acids

11.98

Weight (kDa)

4.79

Isoelectric Point (pI)

37.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018007)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g31112
rosa_laevigata	RLG00000001955
rosa_multiflora	Rmu_co8033230.1_g000001 Rmu_sc0000546.1_g000064 Rmu_sc0002934.1_g000041 Rmu_sc0003382.1_g000025 Rmu_sc0004016.1_g000012
rosa_roxburghii	Rroxscaffold_7G00211220
rosa_samantha	Rh1DG293200 Rh6CG471400 Rh7DG334400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	122
Acc36I	ACCTGC	2 cut(s)	46, 122
AccB7I	CCANNNNNTGG	1 cut(s)	311
AclWI	GGATC	1 cut(s)	108
AcoI	YGGCCR	2 cut(s)	169, 258
AfaI	GTAC	1 cut(s)	196
AfiI	CCNNNNNNNGG	1 cut(s)	311
AhlI	ACTAGT	1 cut(s)	236
Alw21I	GWGCWC	2 cut(s)	37, 304
Alw26I	GTCTC	1 cut(s)	234
Alw44I	GTGCAC	1 cut(s)	33
AlwI	GGATC	1 cut(s)	108
AoxI	GGCC	2 cut(s)	169, 258
ApaLI	GTGCAC	1 cut(s)	33
AspS9I	GGNCC	2 cut(s)	150, 314
AsuHPI	GGTGA	1 cut(s)	23
AvaII	GGWCC	2 cut(s)	150, 314
BaeGI	GKGCMC	1 cut(s)	37
BalI	TGGCCA	2 cut(s)	171, 260
BbsI	GAAGAC	2 cut(s)	63, 277
Bbv12I	GWGCWC	2 cut(s)	37, 304
BccI	CCATC	3 cut(s)	200, 269, 313
BceAI	ACGGC	1 cut(s)	306
BclI	TGATCA	1 cut(s)	268
BcoDI	GTCTC	1 cut(s)	234
BcuI	ACTAGT	1 cut(s)	236
BfaI	CTAG	1 cut(s)	237
BfuAI	ACCTGC	2 cut(s)	46, 122
Bme18I	GGWCC	2 cut(s)	150, 314
BmgT120I	GGNCC	2 cut(s)	150, 314
BmiI	GGNNCC	1 cut(s)	60
BpiI	GAAGAC	2 cut(s)	63, 277
BsaI	GGTCTC	1 cut(s)	234
BsaJI	CCNNGG	1 cut(s)	96
Bsc4I	CCNNNNNNNGG	1 cut(s)	311
BseDI	CCNNGG	1 cut(s)	96
BseGI	GGATG	1 cut(s)	305
BseLI	CCNNNNNNNGG	1 cut(s)	311
BseSI	GKGCMC	1 cut(s)	37
BshFI	GGCC	2 cut(s)	171, 260
BsiHKAI	GWGCWC	2 cut(s)	37, 304
BslI	CCNNNNNNNGG	1 cut(s)	311
BsmAI	GTCTC	1 cut(s)	234
BsnI	GGCC	2 cut(s)	171, 260
Bso31I	GGTCTC	1 cut(s)	234
Bsp1286I	GDGCHC	2 cut(s)	37, 304
Bsp143I	GATC	3 cut(s)	100, 190, 268
Bsp19I	CCATGG	1 cut(s)	96
BspANI	GGCC	2 cut(s)	171, 260
BspLI	GGNNCC	1 cut(s)	60
BspMI	ACCTGC	2 cut(s)	46, 122
BspPI	GGATC	1 cut(s)	108
BspQI	GCTCTTC	1 cut(s)	255
BspTNI	GGTCTC	1 cut(s)	234
BssECI	CCNNGG	1 cut(s)	96
BssMI	GATC	3 cut(s)	100, 190, 268
BssT1I	CCWWGG	1 cut(s)	96
Bst4CI	ACNGT	1 cut(s)	92
Bst6I	CTCTTC	1 cut(s)	255
BstAPI	GCANNNNNTGC	1 cut(s)	299
BstC8I	GCNNGC	1 cut(s)	295
BstDEI	CTNAG	1 cut(s)	121
BstDSI	CCRYGG	1 cut(s)	96
BstF5I	GGATG	1 cut(s)	305
BstKTI	GATC	3 cut(s)	103, 193, 271
BstMAI	GTCTC	1 cut(s)	234
BstMBI	GATC	3 cut(s)	100, 190, 268
BstMWI	GCNNNNNNNGC	1 cut(s)	299
BstSLI	GKGCMC	1 cut(s)	37
BstV2I	GAAGAC	2 cut(s)	63, 277
BstX2I	RGATCY	1 cut(s)	100
BstYI	RGATCY	1 cut(s)	100
BsuRI	GGCC	2 cut(s)	171, 260
BtgI	CCRYGG	1 cut(s)	96
BtsCI	GGATG	1 cut(s)	305
BtsI	GCAGTG	1 cut(s)	304
BtsIMutI	CAGTG	2 cut(s)	97, 304
BveI	ACCTGC	2 cut(s)	46, 122
Cac8I	GCNNGC	1 cut(s)	295
Cfr13I	GGNCC	2 cut(s)	150, 314
Csp6I	GTAC	1 cut(s)	195
CviAII	CATG	5 cut(s)	38, 75, 97, 175, 244
CviJI	RGCY	4 cut(s)	5, 171, 248, 260
CviKI_1	RGCY	4 cut(s)	5, 171, 248, 260
CviQI	GTAC	1 cut(s)	195
DdeI	CTNAG	1 cut(s)	121
DpnI	GATC	3 cut(s)	102, 192, 270
DpnII	GATC	3 cut(s)	100, 190, 268
EaeI	YGGCCR	2 cut(s)	169, 258
Eam1104I	CTCTTC	1 cut(s)	255
EarI	CTCTTC	1 cut(s)	255
Eco130I	CCWWGG	1 cut(s)	96
Eco31I	GGTCTC	1 cut(s)	234
Eco47I	GGWCC	2 cut(s)	150, 314
EcoT14I	CCWWGG	1 cut(s)	96
ErhI	CCWWGG	1 cut(s)	96
FaeI	CATG	5 cut(s)	41, 78, 100, 178, 247
FaiI	YATR	9 cut(s)	39, 47, 76, 98, 108, 176, 202, 245, 273
FatI	CATG	5 cut(s)	37, 74, 96, 174, 243
FbaI	TGATCA	1 cut(s)	268
FokI	GGATG	1 cut(s)	292
FspBI	CTAG	1 cut(s)	237
HaeIII	GGCC	2 cut(s)	171, 260
Hin1II	CATG	5 cut(s)	41, 78, 100, 178, 247
HinfI	GANTC	1 cut(s)	221
HphI	GGTGA	1 cut(s)	23
Hpy166II	GTNNAC	1 cut(s)	35
Hpy8I	GTNNAC	1 cut(s)	35
HpyCH4III	ACNGT	1 cut(s)	92
HpyCH4IV	ACGT	1 cut(s)	181
HpyCH4V	TGCA	2 cut(s)	35, 243
HpyF10VI	GCNNNNNNNGC	1 cut(s)	299
HpyF3I	CTNAG	1 cut(s)	121
HpySE526I	ACGT	1 cut(s)	181
Hsp92II	CATG	5 cut(s)	41, 78, 100, 178, 247
Ksp22I	TGATCA	1 cut(s)	268
Kzo9I	GATC	3 cut(s)	100, 190, 268
LguI	GCTCTTC	1 cut(s)	255
LmnI	GCTCC	1 cut(s)	307
LpnPI	CCDG	5 cut(s)	41, 117, 242, 266, 279
MaeI	CTAG	1 cut(s)	237
MaeII	ACGT	1 cut(s)	181
MaeIII	GTNAC	1 cut(s)	11
MalI	GATC	3 cut(s)	102, 192, 270
MboI	GATC	3 cut(s)	100, 190, 268
MboII	GAAGA	4 cut(s)	63, 133, 242, 277
MflI	RGATCY	1 cut(s)	100
MhlI	GDGCHC	2 cut(s)	37, 304
MlsI	TGGCCA	2 cut(s)	171, 260
MluCI	AATT	2 cut(s)	19, 274
MluNI	TGGCCA	2 cut(s)	171, 260
MmeI	TCCRAC	1 cut(s)	198
MnlI	CCTC	2 cut(s)	73, 264
Mox20I	TGGCCA	2 cut(s)	171, 260
MscI	TGGCCA	2 cut(s)	171, 260
MseI	TTAA	1 cut(s)	18
Msp20I	TGGCCA	2 cut(s)	171, 260
MwoI	GCNNNNNNNGC	1 cut(s)	299
NcoI	CCATGG	1 cut(s)	96
NdeII	GATC	3 cut(s)	100, 190, 268
NlaIII	CATG	5 cut(s)	41, 78, 100, 178, 247
NlaIV	GGNNCC	1 cut(s)	60
NmuCI	GTSAC	1 cut(s)	11
PaqCI	CACCTGC	1 cut(s)	122
PciSI	GCTCTTC	1 cut(s)	255
PfeI	GAWTC	1 cut(s)	221
PflMI	CCANNNNNTGG	1 cut(s)	311
PspN4I	GGNNCC	1 cut(s)	60
PspPI	GGNCC	2 cut(s)	150, 314
PsuI	RGATCY	1 cut(s)	100
RsaI	GTAC	1 cut(s)	196
RsaNI	GTAC	1 cut(s)	195
SapI	GCTCTTC	1 cut(s)	255
SaqAI	TTAA	1 cut(s)	18
Sau3AI	GATC	3 cut(s)	100, 190, 268
Sau96I	GGNCC	2 cut(s)	150, 314
SduI	GDGCHC	2 cut(s)	37, 304
SetI	ASST	5 cut(s)	52, 60, 136, 184, 325
SinI	GGWCC	2 cut(s)	150, 314
SpeI	ACTAGT	1 cut(s)	236
Sse9I	AATT	2 cut(s)	19, 274
SspMI	CTAG	1 cut(s)	237
StyI	CCWWGG	1 cut(s)	96
TaaI	ACNGT	1 cut(s)	92
TaiI	ACGT	1 cut(s)	184
TasI	AATT	2 cut(s)	19, 274
TfiI	GAWTC	1 cut(s)	221
Tru1I	TTAA	1 cut(s)	18
Tru9I	TTAA	1 cut(s)	18
TscAI	CASTG	2 cut(s)	97, 304
TseFI	GTSAC	1 cut(s)	11
Tsp45I	GTSAC	1 cut(s)	11
TspDTI	ATGAA	1 cut(s)	63
TspRI	CASTG	2 cut(s)	97, 304
Van91I	CCANNNNNTGG	1 cut(s)	311
VneI	GTGCAC	1 cut(s)	33
VpaK11BI	GGWCC	2 cut(s)	150, 314
XspI	CTAG	1 cut(s)	237

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.