Rmu_sc0000546.1_g000071

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000546.1
OG0018446
Physical Location & Seq
Forward (+)
333993 .. 334367
375 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
atgactcgtcatatggatgattcgctccagttcgagtatatgaatgaagaataccccagaaggctgtgggtctcactcgaagaaagatttggcaacgtccatgactccctgcttcctaacctagaagtaagatggcatagcctccgcttctatgatttcaattcagttcttgactacaactcggaaccacttcgcattaaatctttgatggaattatgtggaaaagatatcacatatgcaatgttgattgagaagactctctctaccttccccgtctctgctttgatggttgctaagaactatcaaattgatgttactgcaggacggatcacagggtttcatgagctcattggagctatgattaatgttgtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

124

Amino Acids

14.54

Weight (kDa)

5.28

Isoelectric Point (pI)

55.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AclWI GGATC 1 cut(s) 335
AgsI TTSAA 1 cut(s) 160
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
AluBI AGCT 2 cut(s) 346, 356
AluI AGCT 2 cut(s) 346, 356
Alw21I GWGCWC 1 cut(s) 348
Alw26I GTCTC 2 cut(s) 76, 280
AlwI GGATC 1 cut(s) 335
AseI ATTAAT 1 cut(s) 363
Asp700I GAANNNNTTC 1 cut(s) 189
BanII GRGCYC 1 cut(s) 348
BbsI GAAGAC 1 cut(s) 260
Bbv12I GWGCWC 1 cut(s) 348
BccI CCATC 3 cut(s) 126, 202, 280
BcoDI GTCTC 2 cut(s) 76, 280
BfaI CTAG 1 cut(s) 122
BfmI CTRYAG 1 cut(s) 318
BmiI GGNNCC 1 cut(s) 186
BpiI GAAGAC 1 cut(s) 260
BpmI CTGGAG 1 cut(s) 11
BsaI GGTCTC 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 28
Bse3DI GCAATG 1 cut(s) 246
BseGI GGATG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 246
BseNI ACTGG 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 348
BsmAI GTCTC 2 cut(s) 76, 280
BsmBI CGTCTC 1 cut(s) 280
Bso31I GGTCTC 1 cut(s) 76
Bsp1286I GDGCHC 1 cut(s) 348
Bsp143I GATC 1 cut(s) 327
BspACI CCGC 1 cut(s) 145
BspHI TCATGA 1 cut(s) 340
BspLI GGNNCC 1 cut(s) 186
BspMAI CTGCAG 1 cut(s) 322
BspPI GGATC 1 cut(s) 335
BspTNI GGTCTC 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 246
BsrI ACTGG 1 cut(s) 28
BssMI GATC 1 cut(s) 327
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 330
BstMAI GTCTC 2 cut(s) 76, 280
BstMBI GATC 1 cut(s) 327
BstSFI CTRYAG 1 cut(s) 318
BstV2I GAAGAC 1 cut(s) 260
BtsCI GGATG 1 cut(s) 22
CciI TCATGA 1 cut(s) 340
CviAII CATG 2 cut(s) 101, 341
CviJI RGCY 4 cut(s) 64, 141, 346, 356
CviKI_1 RGCY 4 cut(s) 64, 141, 346, 356
DdeI CTNAG 1 cut(s) 294
DpnI GATC 1 cut(s) 329
DpnII GATC 1 cut(s) 327
Ecl136II GAGCTC 1 cut(s) 346
Eco24I GRGCYC 1 cut(s) 348
Eco31I GGTCTC 1 cut(s) 76
Eco32I GATATC 1 cut(s) 229
Eco53kI GAGCTC 1 cut(s) 346
EcoICRI GAGCTC 1 cut(s) 346
EcoRV GATATC 1 cut(s) 229
EcoT38I GRGCYC 1 cut(s) 348
Esp3I CGTCTC 1 cut(s) 280
FaeI CATG 2 cut(s) 104, 344
FatI CATG 2 cut(s) 100, 340
FauNDI CATATG 2 cut(s) 12, 235
FokI GGATG 1 cut(s) 29
FriOI GRGCYC 1 cut(s) 348
FspBI CTAG 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 11
Hin1II CATG 2 cut(s) 104, 344
HinfI GANTC 4 cut(s) 4, 20, 104, 256
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 2 cut(s) 170, 341
HpyAV CCTTC 2 cut(s) 54, 277
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 2 cut(s) 239, 320
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 2 cut(s) 104, 344
Kzo9I GATC 1 cut(s) 327
LmnI GCTCC 2 cut(s) 30, 353
LpnPI CCDG 5 cut(s) 41, 70, 122, 306, 318
MaeI CTAG 1 cut(s) 122
MaeII ACGT 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 313
MalI GATC 1 cut(s) 329
MboI GATC 1 cut(s) 327
MboII GAAGA 3 cut(s) 59, 92, 265
MhlI GDGCHC 1 cut(s) 348
MluCI AATT 3 cut(s) 160, 212, 306
MlyI GAGTC 2 cut(s) 98, 250
MnlI CCTC 1 cut(s) 152
MroXI GAANNNNTTC 1 cut(s) 189
MseI TTAA 3 cut(s) 198, 363, 373
MslI CAYNNNNRTG 1 cut(s) 15
NdeI CATATG 2 cut(s) 12, 235
NdeII GATC 1 cut(s) 327
NlaIII CATG 2 cut(s) 104, 344
NlaIV GGNNCC 1 cut(s) 186
PagI TCATGA 1 cut(s) 340
PdmI GAANNNNTTC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 20
PleI GAGTC 2 cut(s) 98, 250
PpsI GAGTC 2 cut(s) 98, 250
PshBI ATTAAT 1 cut(s) 363
Psp124BI GAGCTC 1 cut(s) 348
PspN4I GGNNCC 1 cut(s) 186
PstI CTGCAG 1 cut(s) 322
RseI CAYNNNNRTG 1 cut(s) 15
SacI GAGCTC 1 cut(s) 348
SaqAI TTAA 3 cut(s) 198, 363, 373
Sau3AI GATC 1 cut(s) 327
SchI GAGTC 2 cut(s) 98, 250
SduI GDGCHC 1 cut(s) 348
SetI ASST 5 cut(s) 99, 123, 269, 348, 358
SfcI CTRYAG 1 cut(s) 318
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 3 cut(s) 160, 212, 306
SsiI CCGC 1 cut(s) 145
SspMI CTAG 1 cut(s) 122
SstI GAGCTC 1 cut(s) 348
TaiI ACGT 1 cut(s) 99
TaqI TCGA 2 cut(s) 33, 78
TasI AATT 3 cut(s) 160, 212, 306
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 3 cut(s) 198, 363, 373
Tru9I TTAA 3 cut(s) 198, 363, 373
TspDTI ATGAA 3 cut(s) 56, 60, 329
TspGWI ACGGA 1 cut(s) 340
VspI ATTAAT 1 cut(s) 363
XmnI GAANNNNTTC 1 cut(s) 189
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.