Rmu_sc0000791.1_g000018

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000791.1
OG0015543
Physical Location & Seq
Forward (+)
61879 .. 63929
2051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000791.1_g000018.1.cds

Sequence Viewer

Length: 963 bp
atggctgagacgattagtccagtgcttatcaatcataggccttttgaacccaacagtaccatcatcaactcccatcattcatccttcctggaccaaaaccctaatgtcgacaccattgtggctgttgatgatatagaaatccccacagttgatttctctgtgctattctctgatgatcttgaaaaaagatccaaggccattgaaaacattggacatgtctgcgaggactttggcttcttctatgaccgaaagcagtatgagaaaaagaacccaacagatagaatccgatggggacttcgatcttctcctgcggagaatagagaatatcttaaggtgattgcacatcctgagtaccactgtcctgctaaaccagctggtttcagtgaggctatggaagaatatttcaaaagactgagagttatagtagatggtttgggaaaggcattttcaaaagccatgggatttgaagaatgctacatagaaaaagcttttaagcttgactcggggttcgatatgtctgcgatgaacttatacccacccaatttcagatcaaaaggttccattggtgtgcctaaccatactgatcctggcttctttgtttcactcattcaagacgtgaatagtggactgcaaatactatcccataagggagactggatcaatgttaacatgccccctaatgccattttcataaaccttggggatcatcttgagatcttaacaaatgggaagtacaagagccatgttcatcgtgttgttgtggacaacaacaaagtgaagaggatctcagtggccacactccatggaccttcgttggactcgcttgtgtctccggcaccagagtttgttgatgagtctcacccacctatatatcgtggaatgacttacaaacaatctttggaggttaacggcggtgacgagatagatgttcaatcgagtcttgaacaaattcggattgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

320

Amino Acids

36.11

Weight (kDa)

5.55

Isoelectric Point (pI)

53.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015543)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g15310 FvH4_2g15312
malus_domestica MD05G1008900.v1.1
prunus_persica Prupe.8G011000_v2.0.a1 Prupe.8G011200_v2.0.a1
pyrus_communis pycom05g00460
rosa_chinensis RchiOBHm_Chr6g0278051
rosa_laevigata RLG00000013242
rosa_multiflora Rmu_sc0000791.1_g000018
rosa_roxburghii Rroxscaffold_7G00190560
rosa_rugosa Rorug06G0114500
rosa_samantha Rh6AG224300 Rh6BG228300 Rh6CG230700 Rh6DG221800
rosa_wichuraiana Rw6G019580

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 835
AccI GTMKAC 1 cut(s) 108
AciI CCGC 2 cut(s) 311, 912
AclWI GGATC 5 cut(s) 183, 578, 665, 711, 791
AcoI YGGCCR 1 cut(s) 792
AcsI RAATTY 1 cut(s) 948
AfaI GTAC 3 cut(s) 58, 353, 734
AflII CTTAAG 1 cut(s) 329
AflIII ACRYGT 1 cut(s) 214
AhdI GACNNNNNGTC 1 cut(s) 15
AjiI CACGTC 1 cut(s) 616
AjnI CCWGG 2 cut(s) 87, 586
AleI CACNNNNGTG 1 cut(s) 116
AluBI AGCT 3 cut(s) 374, 488, 496
AluI AGCT 3 cut(s) 374, 488, 496
Alw26I GTCTC 4 cut(s) 2, 645, 834, 861
AlwI GGATC 5 cut(s) 183, 578, 665, 711, 791
Ama87I CYCGRG 1 cut(s) 502
AoxI GGCC 3 cut(s) 38, 195, 792
ApoI RAATTY 1 cut(s) 948
ArsI GACNNNNNNTTYG 2 cut(s) 491, 523
Asp700I GAANNNNTTC 1 cut(s) 948
AspS9I GGNCC 2 cut(s) 91, 806
AsuHPI GGTGA 3 cut(s) 346, 851, 926
AvaI CYCGRG 1 cut(s) 502
AvaII GGWCC 2 cut(s) 91, 806
BalI TGGCCA 1 cut(s) 794
BanI GGYRCC 1 cut(s) 835
BccI CCATC 4 cut(s) 68, 81, 282, 422
BceAI ACGGC 1 cut(s) 925
BcgI CGANNNNNNTGC 2 cut(s) 500, 534
BciT130I CCWGG 2 cut(s) 89, 588
BcoDI GTCTC 4 cut(s) 2, 645, 834, 861
BfrI CTTAAG 1 cut(s) 329
BglII AGATCT 1 cut(s) 714
Bme1390I CCNGG 2 cut(s) 89, 588
Bme18I GGWCC 2 cut(s) 91, 806
BmeRI GACNNNNNGTC 1 cut(s) 15
BmeT110I CYCGRG 1 cut(s) 502
BmgBI CACGTC 1 cut(s) 616
BmgT120I GGNCC 2 cut(s) 91, 806
BmiI GGNNCC 2 cut(s) 559, 837
BmrFI CCNGG 2 cut(s) 89, 588
BpuEI CTTGAG 1 cut(s) 731
BsaJI CCNNGG 4 cut(s) 192, 456, 697, 802
Bse1I ACTGG 2 cut(s) 20, 659
BseBI CCWGG 2 cut(s) 89, 588
BseDI CCNNGG 4 cut(s) 192, 456, 697, 802
BseGI GGATG 2 cut(s) 80, 343
BseMII CTCAG 3 cut(s) 339, 404, 801
BseNI ACTGG 2 cut(s) 20, 659
BshFI GGCC 3 cut(s) 40, 197, 794
BshNI GGYRCC 1 cut(s) 835
BsiHKCI CYCGRG 1 cut(s) 502
BsiSI CCGG 1 cut(s) 833
BslFI GGGAC 1 cut(s) 306
BsmAI GTCTC 4 cut(s) 2, 645, 834, 861
BsmBI CGTCTC 1 cut(s) 2
BsmFI GGGAC 1 cut(s) 306
BsmI GAATGC 1 cut(s) 476
BsnI GGCC 3 cut(s) 40, 197, 794
BsoBI CYCGRG 1 cut(s) 502
Bsp143I GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
Bsp19I CCATGG 2 cut(s) 456, 802
BspACI CCGC 2 cut(s) 311, 912
BspANI GGCC 3 cut(s) 40, 197, 794
BspCNI CTCAG 3 cut(s) 340, 405, 800
BspLI GGNNCC 2 cut(s) 559, 837
BspPI GGATC 5 cut(s) 183, 578, 665, 711, 791
BspT107I GGYRCC 1 cut(s) 835
BspTI CTTAAG 1 cut(s) 329
BsrI ACTGG 2 cut(s) 20, 659
BssECI CCNNGG 4 cut(s) 192, 456, 697, 802
BssMI GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
BssT1I CCWWGG 4 cut(s) 192, 456, 697, 802
Bst2UI CCWGG 2 cut(s) 89, 588
Bst4CI ACNGT 3 cut(s) 56, 148, 359
Bst6I CTCTTC 1 cut(s) 773
BstAFI CTTAAG 1 cut(s) 329
BstDEI CTNAG 4 cut(s) 6, 348, 413, 787
BstDSI CCRYGG 2 cut(s) 456, 802
BstF5I GGATG 2 cut(s) 80, 343
BstKTI GATC 9 cut(s) 178, 191, 302, 551, 586, 660, 706, 717, 786
BstMAI GTCTC 4 cut(s) 2, 645, 834, 861
BstMBI GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
BstMWI GCNNNNNNNGC 1 cut(s) 371
BstNI CCWGG 2 cut(s) 89, 588
BstNSI RCATGY 2 cut(s) 218, 673
BstSCI CCNGG 2 cut(s) 87, 586
BstX2I RGATCY 3 cut(s) 188, 714, 783
BstYI RGATCY 3 cut(s) 188, 714, 783
BsuRI GGCC 3 cut(s) 40, 197, 794
BtgI CCRYGG 2 cut(s) 456, 802
BtgZI GCGATG 1 cut(s) 536
BtrI CACGTC 1 cut(s) 616
BtsCI GGATG 2 cut(s) 80, 343
BtsIMutI CAGTG 4 cut(s) 27, 355, 388, 795
Cfr13I GGNCC 2 cut(s) 91, 806
Csp6I GTAC 3 cut(s) 57, 352, 733
CviAII CATG 5 cut(s) 215, 457, 670, 743, 803
CviQI GTAC 3 cut(s) 57, 352, 733
DdeI CTNAG 4 cut(s) 6, 348, 413, 787
DpnI GATC 9 cut(s) 177, 190, 301, 550, 585, 659, 705, 716, 785
DpnII GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
DriI GACNNNNNGTC 1 cut(s) 15
EaeI YGGCCR 1 cut(s) 792
Eam1104I CTCTTC 1 cut(s) 773
Eam1105I GACNNNNNGTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 773
Eco130I CCWWGG 4 cut(s) 192, 456, 697, 802
Eco147I AGGCCT 1 cut(s) 40
Eco47I GGWCC 2 cut(s) 91, 806
Eco88I CYCGRG 1 cut(s) 502
EcoRII CCWGG 2 cut(s) 87, 586
EcoT14I CCWWGG 4 cut(s) 192, 456, 697, 802
ErhI CCWWGG 4 cut(s) 192, 456, 697, 802
Esp3I CGTCTC 1 cut(s) 2
FaeI CATG 5 cut(s) 218, 460, 673, 746, 806
FaqI GGGAC 1 cut(s) 306
FatI CATG 5 cut(s) 214, 456, 669, 742, 802
FblI GTMKAC 1 cut(s) 108
FokI GGATG 2 cut(s) 67, 330
HaeIII GGCC 3 cut(s) 40, 197, 794
HapII CCGG 1 cut(s) 833
Hin1II CATG 5 cut(s) 218, 460, 673, 746, 806
HincII GTYRAC 3 cut(s) 109, 667, 907
HindII GTYRAC 3 cut(s) 109, 667, 907
HindIII AAGCTT 2 cut(s) 486, 494
HinfI GANTC 5 cut(s) 282, 500, 818, 854, 937
HpaI GTTAAC 2 cut(s) 667, 907
HpaII CCGG 1 cut(s) 833
HphI GGTGA 3 cut(s) 346, 851, 926
Hpy166II GTNNAC 5 cut(s) 109, 626, 667, 763, 907
Hpy188I TCNGA 4 cut(s) 172, 287, 548, 954
Hpy188III TCNNGA 5 cut(s) 179, 347, 611, 710, 941
Hpy8I GTNNAC 5 cut(s) 109, 626, 667, 763, 907
HpyAV CCTTC 2 cut(s) 94, 819
HpyCH4III ACNGT 3 cut(s) 56, 148, 359
HpyCH4IV ACGT 1 cut(s) 615
HpyCH4V TGCA 2 cut(s) 341, 631
HpyF10VI GCNNNNNNNGC 1 cut(s) 371
HpyF3I CTNAG 4 cut(s) 6, 348, 413, 787
HpySE526I ACGT 1 cut(s) 615
Hsp92II CATG 5 cut(s) 218, 460, 673, 746, 806
KspAI GTTAAC 2 cut(s) 667, 907
Kzo9I GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
MaeII ACGT 1 cut(s) 615
MaeIII GTNAC 1 cut(s) 914
MalI GATC 9 cut(s) 177, 190, 301, 550, 585, 659, 705, 716, 785
MboI GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
MboII GAAGA 5 cut(s) 229, 294, 407, 479, 790
MflI RGATCY 3 cut(s) 188, 714, 783
MlsI TGGCCA 1 cut(s) 794
MluCI AATT 2 cut(s) 541, 948
MluNI TGGCCA 1 cut(s) 794
MlyI GAGTC 4 cut(s) 494, 812, 863, 946
MmeI TCCRAC 1 cut(s) 795
MnlI CCTC 4 cut(s) 217, 379, 774, 895
Mox20I TGGCCA 1 cut(s) 794
MroXI GAANNNNTTC 1 cut(s) 948
MscI TGGCCA 1 cut(s) 794
MseI TTAA 5 cut(s) 330, 492, 666, 719, 906
MslI CAYNNNNRTG 2 cut(s) 116, 566
Msp20I TGGCCA 1 cut(s) 794
MspA1I CMGCKG 1 cut(s) 374
MspCI CTTAAG 1 cut(s) 329
MspI CCGG 1 cut(s) 833
MspR9I CCNGG 2 cut(s) 89, 588
Mva1269I GAATGC 1 cut(s) 476
MvaI CCWGG 2 cut(s) 89, 588
MwoI GCNNNNNNNGC 1 cut(s) 371
NcoI CCATGG 2 cut(s) 456, 802
NdeII GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
NlaIII CATG 5 cut(s) 218, 460, 673, 746, 806
NlaIV GGNNCC 2 cut(s) 559, 837
NmuCI GTSAC 1 cut(s) 914
NspI RCATGY 2 cut(s) 218, 673
OliI CACNNNNGTG 1 cut(s) 116
PceI AGGCCT 1 cut(s) 40
PciI ACATGT 1 cut(s) 214
PcsI WCGNNNNNNNCGW 1 cut(s) 915
PctI GAATGC 1 cut(s) 476
PdmI GAANNNNTTC 1 cut(s) 948
PfeI GAWTC 1 cut(s) 282
PfoI TCCNGGA 1 cut(s) 87
PleI GAGTC 4 cut(s) 494, 812, 862, 945
PpsI GAGTC 4 cut(s) 494, 812, 862, 945
PscI ACATGT 1 cut(s) 214
Psp6I CCWGG 2 cut(s) 87, 586
PspGI CCWGG 2 cut(s) 87, 586
PspN4I GGNNCC 2 cut(s) 559, 837
PspPI GGNCC 2 cut(s) 91, 806
PsuI RGATCY 3 cut(s) 188, 714, 783
PvuII CAGCTG 1 cut(s) 374
RsaI GTAC 3 cut(s) 58, 353, 734
RsaNI GTAC 3 cut(s) 57, 352, 733
RseI CAYNNNNRTG 2 cut(s) 116, 566
SalI GTCGAC 1 cut(s) 107
SaqAI TTAA 5 cut(s) 330, 492, 666, 719, 906
Sau3AI GATC 9 cut(s) 175, 188, 299, 548, 583, 657, 703, 714, 783
Sau96I GGNCC 2 cut(s) 91, 806
SchI GAGTC 4 cut(s) 494, 812, 863, 946
ScrFI CCNGG 2 cut(s) 89, 588
SinI GGWCC 2 cut(s) 91, 806
SmiMI CAYNNNNRTG 2 cut(s) 116, 566
SmlI CTYRAG 2 cut(s) 329, 710
SmoI CTYRAG 2 cut(s) 329, 710
Sse9I AATT 2 cut(s) 541, 948
SseBI AGGCCT 1 cut(s) 40
SsiI CCGC 2 cut(s) 311, 912
SspI AATATT 1 cut(s) 401
StuI AGGCCT 1 cut(s) 40
StyD4I CCNGG 2 cut(s) 87, 586
StyI CCWWGG 4 cut(s) 192, 456, 697, 802
TaaI ACNGT 3 cut(s) 56, 148, 359
TaiI ACGT 1 cut(s) 618
TaqI TCGA 4 cut(s) 108, 298, 510, 935
TaqII GACCGA 1 cut(s) 261
TasI AATT 2 cut(s) 541, 948
TatI WGTACW 1 cut(s) 732
TfiI GAWTC 1 cut(s) 282
Tru1I TTAA 5 cut(s) 330, 492, 666, 719, 906
Tru9I TTAA 5 cut(s) 330, 492, 666, 719, 906
TscAI CASTG 4 cut(s) 27, 362, 388, 795
TseFI GTSAC 1 cut(s) 914
Tsp45I GTSAC 1 cut(s) 914
TspDTI ATGAA 4 cut(s) 69, 539, 679, 737
TspRI CASTG 4 cut(s) 27, 362, 388, 795
Vha464I CTTAAG 1 cut(s) 329
VpaK11BI GGWCC 2 cut(s) 91, 806
XapI RAATTY 1 cut(s) 948
XceI RCATGY 2 cut(s) 218, 673
XcmI CCANNNNNNNNNTGG 1 cut(s) 584
XmiI GTMKAC 1 cut(s) 108
XmnI GAANNNNTTC 1 cut(s) 948
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.